Description :
From Genome Similarity Track
Location :
Scaffold_35:13795- 16810
Transcript NameFunction/comments
Phymu_g2070conserved hypothetical protein
Phymu_g2071aspartate-semialdehyde dehydrogenase, putative
Phymu_g20723,2-trans-enoyl-CoA isomerase, mitochondrial precursor

Sequence
3015 bases(100 bases per row)
cactgctggacaagaaaGACGTCGACTCGAACCAGCGGCGCATGATGCAGTCCCACCTTGCCCACAAATACAGGTACGAGCAGCAAAACAGTGGTTAATC
CCACCAAGCTGACGATTTACACGACAGAAAACGCATCGCTCCAAGCTCACGTCGCTCAAGTCCGTCTTCAAGCGAAGGAAGACGAGGCGATCTCAGCAGC
GGACCAAGTGAGTCGACGAGACAGTTGAAACATGGCGCAGCCGTGCACCAGCTCCGCAGCATGCAGTTCACATCGACACACTCGAAGTTTCGGTCCGAAA
GCAATTGTCTAGGCGTCGCTGGAGCGTCTTGCAGTCCTAGCAGTACAGCTCTAGTGAAAgcgtccagcaacaacaacaagtaCAACTGAGTAAGCTATGA
ATACAGAAGAAAGTGCGCACTACATAGGTACAACATAGCGCTAGAGCATGCTAAGAGGTGTCTTCAATCGGTTttagttcttcttgacgaggCCGTAGGC
TAGCACGGAGGCCACGCCCACAGCGACGCCAGCTGCCAGACCCAgaacgacctgctgctggtccttCGAGAGCGTGCACGTAGTGGGCTTCTTGGTGAAC
TGCGGGATCGCACGCGGGTTCTCGAGGAACTCGGCGATCAGCACGGCGTTGAGCGCCGCACcgcgcaggagctggtcgcCAGACACGAACAGCTCCAGGC
CGTGCTCACCGAAGACCAAACTCTTGCGCAGCCGGCCGGCTTCGATGTTgaacttcttggtggcgttCTTGGGCATCGGGTACAGCAACTTTTCCGGTTC
ATCGACGAGGTCCACGCCGTCGGCCTTAGCTAGAATCTCGCGAGCACGGGCAATATTCACGGGCTTGACCGTCTCGATGGAGAGGGCCTCCGAATGAGCG
CGCATGATGGGGATACGGGCAGCCGTGCAGCTCACAGCAAGGTTCGGCTCGTCGAAGATCTTGCGCGTCTCCCACGTGaccttcatctcctccttggtgT
AGCCGTTCTCCTGGAACTTGTCAATATGCGGGATAAGGTTGAACGGAAGCGGGTAGGAGAAGACCTTGTTGGAAACAGGCTCGTCAGCCAGGAAGGCCTT
CGCGccgtccgccagctcctccatgcCGGCGGCACCGGCGCCACTGGCAGCCTGGTACGTCGACACAATGAGCTTCTTAATGCCGAACTCGCAGTGCAGC
GGCCAGAGCGCCATGGCTGCGATGGCAGTGGTACAGTTGGGGTTGGCGATGAGCTTGGGCTGCGGCTGTCCGtccttcgtcagcagcacgtggccGTTGA
TTTCCGGGATCACGAGTGGGGTCTCCGGGTCGCGACGGAAGGCCGACGAGTTGTCAATGACCACGGGGCCATTGGGCACGGCAGCCAGTTCCTTGGCGTA
TTGCAGCGAGAAGTCGCCCGACACGGCAAGGAACACGTAGTCCAGCTtggccgccttctccaccgagaagagcgagatgGTCACCTGGCCGAAGGGCGTG
TCCACCTTTTTGCCGGCGGAGCGCGAGGACgcgaagagcacgagctggCTGACGGGGAACTTGTGCGCGGCCAGCACCGAGATGATCTCGATGCCCACAG
CGCCCGTGGCGCCGCAGATACCGACCGTCTTGCCGTTGGGCGTCGTCATTGCTGTCGATCGATGGAGGACGTTGCGCAGGAAAATTCGGTTATGATGGGC
GGCTCCTCTCGTCCATGCGGTGATAATTGCTCAAACAAAATCTTGTGGTGCGTGACGCGCCCAGATGACGAGGCCTATAATACTTAATGGAATCGTATTT
ATACGAGTACTTACTGTATATATTGTACACAGTTAGCAGTATGCCAATTGTTTTTCATATGCACCATATGATATCTCCAGCTCATAAATTTACGTCTACA
AAGCTATCATATCAGTTTGACATCATATAGTATCGCGTTTAGGTACGAATTCCTTAAGTTCgcattgaagctgcttttcACGTCTTCACGTCGACATCGC
AAGATCCGACCGCAGTAGTGCATTACCAGAAGCCCCCTCCAACGCAACGACGCCCATGCTGCCTGTTGCCATGAAGCCTGTTCTACGAGCGCCACGTCTA
GGAGCGCTAGCATcgcgcgccttctcctcgtcgggTGAaccgctggtgctggtggagaagaaggacaagtacGCGGTTGTGCGCTTGAACCGCCCGCCCG
TCAACTCTCTCAACACGGCGGTGCGTCTCGCTCCAGAGTAGAGTTTAGCAGTCCGTCATAGTTTAATGACttgctgtttgctgctgtagttgATTCAAGA
GCTGGACGCGAcgatcaagaagctcgaggacgacaAGAGCGTCCGGTACATTATTGACCCTCTATTGATCTGTGCACCATCAATTTTGACAGTCGTGGTT
GTATTTTTACTGGATATAGCGGCTTCATCCTGGCGTCTTCGAACCAGAAAGTCTTCTCCGCTGGCCTGGACATCATGGAAATGTATCAACCACAGGTAAT
CATTGCCAGTAATCAGATACGTCTCCTTGACATCACAGCTTAAAACTATACTACTATGACCAACTATTGCCAGCCTGCCAAAATCACCAAGTTCTGGACG
TCCCTCCAAGACCTGTACCTGCGTCTGTATACGACTCgtctggctgctgtggctgcgatTGAGGGCCACAGTCCGGCGGGGGGCTGCTTGCTGGCCATGT
GCTGTGACTACCGCATCATGACGAGCGGGAAACCGATGATCGGCCTCAATGAGACTCAACTGGGCATTGTTGCGCCCACGTGGTTCCGTGATACTTTTGT
CAACACTATCGGCCATCGTGAAGCTGAGAAGATGTTGGGCCTCGGACTGCAAGTGGATGCCACCAAGGCGAAAGCGATCGGATTGGTCGACGAGGCCGTC
AGTCTCGAAGAAGTTTTCCCGCGTGCTGAGGCTGCAATTGGCAAGTGGCTAGCCATTCCGGGTACGATACACTGCGTTTGGAGATTGATGGAGGGCTAAT
TTGACTCTCGTTTGT