Description :
From Genome Similarity Track
Location :
Scaffold_9:137948- 141900
Transcript NameFunction/comments
Physo_339872Hypothetical protein

Sequence
3952 bases(100 bases per row)
GTCCTCTAACCGAGAATCCTGTCTGTCGGTCATCGAGTCACGCTTTCCGCCCCTACAGCCTAGACCTGTCAATTAGACTACGCTACCGCGGCCTTATTGC
ATACATTATTCACTCATCAAGTCGACTGGAACTGGCTTTTGAACTATCTACGAAATTACAAAAATAGCCACAATCACGCTACAATTCGGACTTCACGGAG
CCGGTCGGACTTAAGCGGGCGTGATGAGGGCGCCTGGCGTAGAGAAGCGAGTGGCGAACTGCAGCGGCAGCGGACACACACAACAGTGAGTACTGCATGT
CCATACATAAATAAACTACTTTACGGTTTCGGGAGTTCCGCCTGTTGGGATAACTGGTACCTTCAGGGCAGTCGAGGGTTTACAGTACGGAATTAGGGGT
AGACTGGTGCTTATTAGGCGTTCATCTTCTAATACACCAAGAATGTGTGCGAACGACGCATTTAGACCACCTAACGCTGCACATAGATTAACTGATAAAC
AGCACGCGGCGTGGTGCAGCTGGCAATCGTGCTGTATTCATTTGCAGGAATCAAGCATTATAATACACCAATTTGAGTAGTCGCGTGCTCAACTTAAGTT
ACTACTACGTAGTAGTTGGTCGAATTAAGTAAACCCAGGTGCATCACCAGCGCGCGCATCGAGGCGTCATACTTACGACTTTTTATGTTGTTAGAGAGAC
AATCGTAACAAGCTTGTTAGGTGGGCTAAAGAAATCTAATGATGCGCTAATGTCAAGCACAAGGAAGAATTCGCCCAGTTCCTCCTCACTACGTCAGTTA
GGAACAGGGCGATTTCTTCCTCCGCGTTTATCGCGACGTGCCGAAGATGGGTGGCTGGAGCCGAAGTATGCTGCCTTAGCAGCCTTGCAAGGTATTACCA
TGTAGTAGGTTTTGAGCGTGCTCTACGCTCGCCACGACCAATAGAAGCTCGCCATTTCGGCATATGGTGGATACATTGAGCATGTTTTGTTCACTTTCGT
AGCTGTTCTGTGCACAATGTACCCAGCGCTTGACCGCAAGATGCGAAAGGGCTTCCAACAGCAAATCTTTGACAGGTTTTGAAGTATACTTTAATCAAGT
ATAATGCTTATTCTGTAGGATACAGAATAAGGTCTGGGGCTAGAAGGGTTAAGCTGATTAATGGCAGGATCTTGCTGCAGTCCGACACTCGCTTCCATAG
GAACGATAGTCGCATCAGCCAAGTGACAACAATGCACTCCAACTCAAATCAAAATCGATCATATCCCAGGTACCCTAACTCTCGCGCTTCAACAAAACAA
TTTTAGAAAATGCTGCTCGAATTACGCGCAGCGCACAGCATGGTCGTGCGCAATTTCGAATTACTGTAGGATAAGTAGTATTTGGCCGGAAACCCGAAAG
CTTGCCACCTCGCTGTAGCTAATCAGCGATTTGTTTCTTATCATTTGAGGCCCAGTGACCTATTTTCATCCAATCGTCGCTCATTAGGGTTAGGTTTATT
TTGTTCCAACTTATTTCTGGAATCGTCCGGAATTTCCTTCTTCGCGCAAATAAGTAACCATACCAAACTAAAAATGTTTCTCGTACTTAATCGATAGGAG
CAAAACCTGCCGGATGTAGCCACTTCCAGACTTGCCCAAGCTGCTCGACACTGTAGCTGGAAGGTCAAGGCCGACTCCAACAACCCAGCAAGCGCGGTAG
TAAAGTAAATGAAAGACAGAATGGTCAAGTAAATAAATGAAAGAATATGTAGCAATCTTGATCGATAAACAATCAAACAATCAAGGGCTTGATGTCTAAT
GGTACTAGCTACACTGCGCTTGGCCGTCCTGCAGCTGCGTGTTCGCGCTAAGTGCCGCCCCAGGTCCTTGGTCTTGCTCTCGCGCTTGACGAAATTTACC
TGCTCCATCGTCTCATTGGGGTCGAGGTTGCTCCCTTGCCGCTCGTTCAGTGGGCGTCCAGGTGTAGTAGCGCGCTGCGGGTCGCGTCACCGCTCACGTC
CTCGCTGGTCACTGCGCTCGCCACTTTGGTCGGCATCGACTCCGTCGTCTTGGTCGGCGGACATCGCTTCAAGCGGGCGGAACGCCCAGCCGTACCCAAG
ACATTCACAGCGCCGTTGGCATCCGCGGACAAGCCGGCCGCCTTGCTGCTGTCGCAAGAGCCTCTTCCTTCGTCGCGGCCTTCTCGGTCTTCTCCTTCGT
CGTCTCCTCGGGGATGTGGTCTTCCGTCTGCACCGCAGCATCTGCTGCCACGCGGTCGGCTGCCTCTAAGTCTTCATGCTGTACCTGCCTGCTCCTCCTC
CAGCTTCATCACCTTCGACGTCCTCCTGCTCCTGCTGCACTACATCCAGGGGCCCCGCAGTCAAAGTCTCGCCCGAAGCGCTCTCCTCCCGCACCACTTG
AATGTAGCTCGTCCTCGCGCTGCCCGCGCGTCTGCGCCTGCTGATCCCACGCCGTTCCCTCTTGCCCGAGTCGGCGATGCTCGCGTTCTTACATCTCCAC
CCCGTCGCTAGTGCGTACAGCACCACCGCCAGGCGCTCCGGCGACTCTTGGTCCACTTCCGGTCCGCCCGGAGAGCTCATCTTCGCCGCGTACGCCGAGC
TGAACGCCGCCGAGCACAGCGCGAGCGGATATAGGCCAGTTTTCTTCAATATTGTTGGTGTAGGCGCGATTGGGTGCGCGTCGTAAGTCTTGACGAAGAT
GTAGCCGCCACTTATCAGCGCACCGTGCCGCGGTCGCTCATGCCCACAAGTTAGGCGCCACGCTGGGCTCCGACAGCGCCGGCCCGCCGCTCCTTCCACT
CAATGTACGCGACACATCCTCCGTTTGCTCGGGCACGGCTGCAGGCTGTCCGTCGTGCCCTCCATTGCATCCTGCGCCACTCCAAAGAAAGATTGAGAGA
AATATAACATTACATAAGTGCAAATATCACACTATCCGCTGCCGTCCGGAATGAATAAGTGGGCGCTGATTGGCGCAAGTAATTTTATGTGTCGCCAGTG
TGTCTCTATTGCAGGTATGACAGGTTTACGGATTCCGGTCCGGAATCTGGCAATTACTGTTACTAAGTACAGTACGCCATGCACCAAGAGCAATAACGCG
TTATAAATCCAGATGAAAGATGCAGAGTAGGCAAAGCGTAGAATAGTAGTGACACTGGCAACGCATGCAGCTTTCAAAATAAATGCGCGCTGCTACCCTA
GATACGTGTACCGTAAACTACTGCAGCATGCACATAATGCAGCTTAGTGTAGACATTGTCGTTAGGGCAATATATATATGAAGCTATTGGCCGGACCCCG
GGGCCCCGCATCATGTATCGATGGCGACCGGAATTATTTATTTTTATCGGCGGGGCAGTGATAATATATATGTTGTGACAATTTTGTGATAATTTTTCGA
GTTTAGCTAGAGCTCATTTCACCTTCAAGCATCTAGCATCCAGTATGAAGTCTAGGCGAACTGGAGGTGCAGAGGTTCTTCGGCGCAAACGTGATACTTA
AGTATTGAAATCGTCGTGACCACAAAGCTGCTGCATTCGTTCGTTCTGTTAAGCGTCTTGGTGAAGATACGACCAAGAAGATTCAAGCTGACTGCTAGAA
GCTAGCGTCTACTACAGCAGCAGCGGCGTTGGGCACGCAAAGTTGCGAACTCTGCAGCTCTGTGCAACTCGATAGTCGATACTACCAGAGATACATAGCA
TCGATACAAACATGCAGCACTTGAATTTACCGAATATACCAGTTGCTTATGACAGCTGGCGGGGCAAGCGGGGACCCGGGGTCCCGCCAAACGCTTCATA
TGCATATACACGATACACAACAACCTAACCATCGAAAACGCACAGTCGCTACCGATCCGTATTGAGTTGAGCTAAATTTGCTATGTCTATTTGAACTGTT
ATCGCGCAAACCAGCATTACTACATGTAGCGCGGTGCAGTGCGTAAATTCAT