Description :
From Genome Similarity Track
Location :
Scaffold_85:13785- 18792
Sequence
5007 bases(100 bases per row)
CGCTTGGAGGTTCTTGAGCGTGGCGGTTGTATTCGCCCGAGGAAGAGACCTCGTGATGACGGTACGGGCGAATACAACCGACACAAAACATAAGATGCGT
ACGCATACTACGAGGCAACTCGATCGTGTACGCATTGCCTTTGCGATGTAATAGACGGAATAGGACGATGTACTTGGGTAGTAGTTTACTACTACCCACA
TTAGTTACTACGTGCTTAGGTAGATTTACCGTATACAGTAGAACTAAGTCTCCGACATTATATAGAAGAACATTTGCTCTTTCATGATGTCAGCGTTCCG
TTTCTGCCGGTCCACCGCGTTAGAATGGCTTCTTGCACGAAAAGGACCACTGCTTCTTGTGCCAGCATGAAATCTTCTGCTGACTCACTTTGGTTTGTTG
CAGTGCGCCTTGTGTGCACCAATAGGAGGTCATCCTCTTTTTCAGCGAGGTTGTTCTCATCCTCGCTGGTGTAGTCATTGGCGATGCTAAATATACCAGA
ACAGTCATCCTCATCTGGGTCAGAAATAGTGTCGTCACTATTGCTGAGATCATCAGCTTCGATTACTTCGACACGTTATCAGCAAGAGCCAGAAGGGTTT
TTGCTCGATCGAATCCCTCCTCCCTTGATTTTAGTGTCACACTCTAAATGGGTGGGTAGGCGTGGATGGCGTAAGCCGTTCACGAAAAATGGTGTATGCG
CTGTCGATGCATGCACGGAGTTGTTGATTGCAAACTCCACCATCGTCAAAAGATCGCTCCAATCTGTGAAAGATTGGAAGTATCCTCGAAGTATCTCTTC
GAGGACGCGGTTGACGCGTTCTGTCTGAACATCAGTCTCGGGATGGTCAGAAGTAGACATAGTCAGACGTGTTATCGAAACACGGATTTCCAAAACGCCG
CCGTGAACCGATGATCTCTATCAGAGAATAGTTCACGGGGTGGACTGTGAACTCGGAATAACGTGTCAATGAAGACACAGGCACAACAATGTGCTAAGAT
TGATTCATTAATTGCAGCAAGATGTACTATCTTGCTGAATCGGTCTACAAACACAAATATACCATTATTCTCGTGAGCGGTTTCGGAATAACCTAAGACG
AAGTCCATTGAAACGGACTGCCAGCAATCTGTCGGGATTGGTAGAGGCTGTAGCGGCGCACGGGATGAAGGACTGGGCTTCACCCGTTGGCACACTTCAC
AAGCACGAATGTAATTGCGCACGAAATGATACTGGCGGGGCCAGTAAAAGTCGCGACTTACCGTGAGATAAGTTTTCTCACGCCCACGATGCCCAATAAG
TGGTGCATCATGGCACTCATACAAGATGCGCAAGCGCAGATCATTATGAGTGGGGACGACGACACGAGGTGTGTCGCTGACAACAGCTATATAATACAGC
AACCCGTTGCGTGTTGTGTATCGATCCGCGGAAGATCAATACAAGGCCGGTAAATCTTTGAGAGATTTACGAGATGAAGTCACCAGATGATACATCAGTC
GCAGAAGAGCCTTATCTTCTGTGTAGGCCTTTTTTAGGTCGTCAAGCAATGTTGACGACGGGACACTAGTGACTAGTGTTGCAACAGTGGTATCAACCTC
ATTGTTGGACTGCGCAGCCGACTCGAAATTGGGTCGGCGCGACAACGCGTCCGCGACGACATTGAGTCTTCCGGGTTTATACTCCACGGGGAAGTTGAAC
TCCTCAAAGAAGGACAGCCACCTCGCCATCCTTTGCGAGAGGTATAGGCTGTTTATGGACGTGCGTAATGACGCATGGTCCTTAAAGACTACAAACGGCC
TACCTCCAAGGAGATAGACGCAAAATTCGCTAGTGCATACTTCATGGCAAGGCGTTCCTTGTCATGCACTGGATAATTGCGGTCAGTTGCTTGCAGCTGA
CGCAATTGATAAAAGACGACGCGCTCTGCGCCTTCTGCATCGTATGCATTAACGCGCAGAAGATTGCAAAATTGCTGGCGTCACAGACCACATGGAATGG
TATGTCTTGGTCTGCAATCGCCAAGATGGGCGATTGCATCAAGCTATGCTTGATACCTTTGAAAGAACGCTGACAATTAGCGTCCCATGACCACTTCTCG
TTCTTTTTCAGAAGACGAGAGAGGTGAACAGTCATCTCGGCGTAGTTGCGCGAGTACTTGTGTAAGTACGTCGCTAGACCAAGAACCTTTTTAAGTCCCT
CAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCTTTTCTGGATCAGGGCGTACGCCGTATTTACCCACGATGTACCCAAGAAGTAGTATTTC
GCTAGCAGCGAATATACACTTCTTGAGATTGGGATACAGCTTATGCTTGCGCATAAGTGTAAGAACCTGACCAACGTGTGTTCTATGAACCTCTACGTCC
GTCTTTACGCCCATAGCCCAGCTATGGACGAATACATAGTCGAAGTAACTTGGTGCAAAGTCTTGCACCGGTCTCAACAGATTTCTAACACATCTGTTGA
AGGTGGCAGGGGCGGTGCTAAGCCTCTGTGGCATTACTAGCTCCTCCCAGAGCATACCTCTCGGGGTGCTTACTGTCGTGTACGGGATGTCCCGTTTACG
CATTAGGATCTGACAGAAGCCATCTATCAGATCGGTGGACGAAAAGATGGTACTCTTTGACATACCATCAATGTCCTTCCTCAGTATCGGCGTCTGAGCC
GGTACCGTCGCAGCATTCAACTTGTTGAATGCATGCACTATCCGCCATCTTCCTGTGGCCTTGCGCACACAGAAGGTCGAAGAGCTGTGAGGGGAAACTC
CCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCCATTGCAAGTACTTGTCCACGAGGCAGTGGCCACTTCTTCATGACACAGTACTTCGAG
CCTAGTTTGAGCTCGATTTCATGTCGAGTGACTTTATCCTAGGCAATTCGCATGGTTCGGATTCAGGGAACACGTCCTTGAATTCGATCAAATCCTTATA
TAAAGGATTTGCCTGAAGAGACTCCCACGATTGATACGTTTATCGTTCAATCCGAGTCTTCTCATCGCGGACACTTTCGTCCATCGATGAACTGCTGAGA
ACCCGTTCTTTCTCGGCAAATATTACTGCCAACCGAATGTCAGTCACGTAATCGTCCTCCGTGACGAGTACACGGATCTGCTTGACCTTGCCGCTTCGTA
GATATTGCAACAACCGTCTTGGTTCTAGCGTCGGAAATTGAGTGATCTCCGAAGTTAACTTCGGAGGCGCGATCAGATCAAGTGTATAATCGCCTACACT
TGACCCGTCATTAACCAAGACATTTAATGTCTCGGTTTCTTCCTGGGAACCCTTTTCCACAGGCTGCTGGGGACTTATTCCCTCAGGCTGATGAGGTCTC
GTTACCTCACCAATAACTGCTTGAGGAATTTCTTCCTCAAGTACGTGGGGACTTATTCCCCAACGTCGTCTAGCTGTGGTTGCGCTACCACAGCTAGGTC
CTCTACTATCGACTCTCCAGCCGATCTAGGATCATCGTGTTGTCCTGTGTGGGCAACTGGTTTATTCTTACTTGGATGTCGCCTGCTAGGCGTACACCCA
TGTCCCAATCCACTCGACTTGTTCGAGTAGTGGACCTTCGGTGCTGCCTGTGCATCCGCACAGCCGCCGGCAGCTTCCCCCACAGTGTGGTAGGTTGTCA
CACTGTGATTTTGTGCAGTCGTACTAGCGATCGTACCGCAAGTGAGGCCATCGCACTCACTCGCAGTAAATCCACACGCTTGTGGACGCTCCAAGACGTT
CATCAGATGGCCATCTGATGGCAGGCATCTTCACGGTTCGATGCTGCCAGATGACCTTTGGCTCGTACCTTCTAAGCTAGGGTAACCCTTGGATGACATC
AAACTTTTCATCCAAATCCAGTACGATGAAAAATCATCATACTGCAAATCTTTCAGCGTGTAGTGAAATCCCACTACACGTTTCATCACTGCTATCGATG
CGCCTGTTGCGAGGCGCACCGTTATCCTCTTAAAAAGAGTAACGCTCTCAACGAACTTGAGCCTACATTTTTCTAGCGACTGGAGACGTACAAAGTTGTT
CGACGCCCACACTCAACTAAGGCACGAAGTGACAAATCTTTTGTCAATTCTAAATTCAAGGTGATGAGGGGTACCTCATCACCAAGTGCGGAGACACACA
AGGATTGTGAGTCTGGAGCAACTTTCTTCAATAGGTTTGCAAATTCTACTGAGGTTGCTGTATCAGTAGGTGTGGAGCGCCCTACTGACCCCGGCCGTTT
TTTGACGGTCCGCCACGCTGTTGTGACTTCGCAACAGCGTCGGACCCGCGTCCGTTGCCCTTCTTGGCAGACGGTCGATCACTCTGTACAGTGTTACAAG
ACACTGGGCGTGAAGCACTACACTCGTAGGCGTAGTGTCCTACTTCTGACAGCGATTGCACTTTTGCAATCTCTTACTGCTTGAAGAGCGATGTCTCTCG
CTCTCGACACTGCAGAGGTCCATTGGTTCTGGACCTCCCGTCTCTACTCGTCTTGAAGGACGATAGGGGGTCAAGCTAGTGTGATCCTGTCTCACACTAA
ATTCCTCTTGCACCCCGGCTGTAATAGCTTCCTCAAGCGACTTCAACTCGATGCGGAATAGGTGGTTCCTCACGGGACCATCTATAAGGCACTGTAAGAA
TATCGTGATCAACACGAATTCACTTACAGGGTTCACTACCATAAAACTTACAAGGTAACGAACGTGCTGAGCGTAAGTGTGAACATCACGCTTACCTTGT
TTTATCTTCAGGAGATATGAAAGAGTCCTGAAGTCATCTCTTGGCGGCTCACACGTTTGGCTGAGCAGAGTCTTAAAGACCGCCAACGATTCAAACACGT
TTGGATCGTGTGATTGAAAATGCAACTTGCATTTCCTCATCGTCGATGTGGCGAGCCTTAATGGCATCGTCCACTTCGAGGAACCATCTCAACAGGGAAT
CTTCCTC