Description :
From Genome Similarity Track
Location :
contig_21:1378- 6263
Transcript NameFunction/comments
g4752.t1hypothetical protein

Sequence
4885 bases(100 bases per row)
GCTACTTCGATACCCCGGAATGAGTGGATCCCAGGGATTACTCTCATGCGTATCGCCCAGCAGCTGATGTCGCCCCGTGGGACGTGCGATACGTTCGCCG
TGTCTGCGTCCTGGAGATGGACTTGGATCTCCTTTACCACCATTTCTGTCGCCCCAGGAACTGGCTGATTCCTGTTCGCACTACTCACTCTCGCACTTGG
CGGTCGGATTTGATCACCACCGCCCAAGTGCAGGCGTTGTATGCAACCCGCCCCTGGGAGATCTTCGACACCATGATCGCCCCAATTTCTTTCAGCCTCT
CGGGATGGTTCGCGCCTATGGCTCAGCAGTATCAGGACCTCATCCATGAGCATTCCCAGGCTGTGTGGGAGGCTCTCCATCACTTCACGATCAGCGCTGA
TCGTCGTGCGCGAGAGACTTACCTCGAGACTTTAGCTGCTGAGCGCAAGCAGCGTCAGTCACGTTTCGGTGCTCGGCTGAAGGTCTTTCTCCGCGTCATA
CTACGTGGGTTGGTAGAAAGACGGTGTGACCTTGACATCTTGTTGGATCCATTCTTCGTGTACCGGCCCAGAACCGGTGAGGAGAAGGTATGGTATCCTG
GCCACGGTATTTCTCCCAGGTTTACCGACTTGATCGCCATCACCCCCGCGACCGACATTGCTGAACCATGGCGTATACAGCACCGATCGGCCATCCAGGC
GCATCCGGCATATGGAATCGGGCGTTTGGTCGGTAAGTTCACCCCCTTGGCCTCTCTGTGATCGTGTAGGTCGAACTTCATAACTTCGTAGCATCACTGT
CTTCCTTCTTCCTATCTCGTCTTCGTGGGGCCGACCACAGATGATCCTCTTGCTTAATACTCATTTAATCCACATAAACCCCTTCCACCACCGCGTGCAA
CCGTCTTGCACCCGTATCCACCTCTAATCAGCAGCATTTGCTACTGATCGTTCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACAACTGCGGCTAGT
GCGATTCCGCTCGAACTCATATAGCAGTGCCCCGCAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTATTCT
CGATGGACTCGCCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATCGTTATCACCCAACATTCTCCCAGCTATCTTCTG
GTAGAAGTGCTTCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACTTGGAGAC
GTGCACGATCGGAAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATGCCACATA
TGCGCAAGCTTCCGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGTCTCACGCCTTCGTTGTGTTG
ATCGGCTCTAGCTTGTATCGCGGCCTTGAGACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTCGCGGCTCG
TGGTCAACCTCCGCGTACTGCCGAGCGGCAACGACGCCTCTAACGTTGATCGTGGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACCGCGCACCC
GATCGTGAGCGGTGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATCTTCAAGGCGCGAGTGAG
TGTCTGCACCATCCTCTCTGCCGTGCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGCGGAAGAAA
TCAGACATAAACCCGGGTTCCCGATCATGGCGGATTGCCTCACTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGTCTGTGCGG
TCCGCGAAGCACTAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAGACGGTAT
ATGGTCCATCGCAATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCACAATCCAAA
CATTCCCCACGAATCTCTGGACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATTCGCTGGTACGTACGGCCGATCCCCTGGTGTCCGCCCTC
CAAACTGGCATGATAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGCGTTATGTTC
CCGCAATAGAACAACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAACGTCTCCTC
TCAGGTAAGCCTTCAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGTTGTACGATCGTCTCTTGCAGCGAAGC
CGATACTTGGCGTGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGCACTTCACCTAATCGGTTGATC
GCGATCAGATCGTCGATCTCCCCTTCGGCCGACACAATCGCCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGTTCCAGTCGCG
TTTCACGTGGAGTAGGTCGTGCGTCGGCCAGGCCTTCAGTGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTCGATCTCCCCTC
TCATTTGTCGGATGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGACCGCGGTATTC
GGCTTCATTCACCGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATGCTCCCGCGCTC
CTCTTGACACGTGCCGAGCCGTCGAAGCTTACGACAAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTATCTGCTTCGGTTCCTTAA
CTGGAGCTATGGCGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTGGTGCACTTCCT
GATCTCCATCATAGTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCGAGTATCTTGACAGAACTTTGA
TCGATCGGTTGGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTAATTCAACTCGTTCGACTTCAA
CGTACGGCTCGTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTCGCATATACGACGATCACCGGT
TGGCGATCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATGAATGCTGTCTTCGCACGGACCCAGCGGTCGTTCGCTTT
GCCTGTTTGATCGGCATTTCCGATGCGATTTATCTCGTGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATACACCGCGAAGTCCTCGATGAAC
CGACTATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGACTCGAGATCTTTCGGCTTGGCCT
CCAACCCTTCCGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGATATCCCCAGAAACTTTTAACCACGCTGATCGACAAGTTCCACCGATCACAGGC
GTCAAGCAGTTTTTCTACTTTCTCGCAAACGTCGTCCCAAGAGCCGGCAGATCAGGATATCATCGATGTATGATCGACGCCCCAGCACTGAAGGTCTCGG
TTCATCCTCGGGTTCGCCTTCCTTGAACACGTCGACCAGCTTGGAGGATCAGCGTTTGGACTGATTCGGAAATGTCCATACAGCGCGTTGTCTATCAGTC
GTTGGTAGATCTGTGGGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAAAGGCTGAGATCTTCCGAGCGCGTTC
TGTCATTGAGACTACCCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAAAAGATCGTTGACCAAAGGCATGGGG
TACACCATCAGGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTTTTCTTGATGATGATCACGATTGGTGATGCCC
ACGGCGATGTCGAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTGCGGAGCTACACGTCTGACGCGTTG
GGCCACAGGCGTTGCTCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTGCCGATCAGCAAGTGACGGCGACGC
CAGATGATTTGCCGCAGGCGATCAATCTCTTTTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAGACCTCGTCGGTTGAGCTGGACA
CCTCGGGAAGGATTGCCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGTCCTCCGC