Description :
From Genome Similarity Track
Location :
Scaffold_104:1378- 2735
Transcript NameFunction/comments
g17100.t1XP_009535150.1 multidrug resistance protein ABC superfamily [Phytophthora sojae

Sequence
1357 bases(100 bases per row)
CTTCACGGAGCCCCCGAGCGGGTCGTAGAAGCGCTCCAGCAACGAGATCACCGTACTCTTGCCGCTGCCACTCGGACCAACTAGCGCCACCGTCTCGCCA
GCCTTAATCTGGAGTGAGTACCCGCGACACACCTCCACCTCGGGACGAGACGGGTAGGCGAACCGCACGTTGTCAATGTCGATGCTTCCAGAGACCGTGT
TGAGTGTCTTGCCTTGTGTGTCGTTGGTGGGGTCGATCAGTGACGGACGCTTGATCAACTCAAACACATCGAAGGCAGCAGCGCATGCGGAGAAAACAGC
TTGGAGATTGGGTCCTGCCTGGCCCAGTGCCATCGCACCTTGCAAGACTGCGAAGAATACTGTCAAGACACGGCCACCGTCGTAGCAACTTGATCCTGTG
CACGAGTTACCGTCCAAGTTGTCGCGAGCGACAAACACAGCTCCGATAAAGAATCCCAGCGCGTACATCAGGAAAATCATCATGTACATGAGTCCGCTGC
CCCAGCCAACAGCAAAAGACTTCTTGATCCCAGCGCGCGTGGCGCCCTCGAGCGCACGGCTGTACTTTTCAACGAAGTACCCCACAGAGTTGAACATGTG
CACCGTGCGGATGTTGCTGAGCGACTCTTGCGCCACGGCACCTGCCTGCGCGTATGACTGCATGCCGCTGTGAGTAGCGGCGACAATGACTTTCTTCGCC
ACCATGCCACTGACGGCGACGAACGGGATCACAGCCAGCAGAATGAGAGTGAGCTCCCAGCCTTTCACTAGGCCGATGACGATGCCCGCCACCACAGTCG
ATGAGAAGTGCAGCATGTCGCTCATCTTGGACCCGATGCCGTCCTGGATGGTGATCGTGGCTTCGGTCACACGCGAAGACAACTGCATCGGGTCGTTCAC
GTCGAACCAACCGATCTCCTTGGTGATGATCGCGTTGACGTAGAGGCTGCGGATGCGCTTGGACTGGCGCGACGCCGTGAGGGACCAGCAGTACACTTGC
AGGTAGGCCGCGACAAGTCCGACGGCGCCCACGATGGTGAGGTTGCGAGCAACTCGGTTGACGCGGGGCGAGATGTCGGCGGAGGACCCACCGTCCAGAC
TCGTTGACCCGAAGGAGTTGATGACATTGCCAAGTAGAACGACCATCAGCGGCCGCAGGACACCGGCGACCAGGGCCCCGAGCGTGCCGACGCCCATGAG
CAGCTTGTCGATCGAGTCTGCGAAGGAGAAGAGCTCCGCCAGAGGCACTTGCTTATTGGTCGCCGCAGCATCCTCGGACACGTCCAGGATCTTGGTCGCC
TCGGCGCCAGGTTGCGATAGTCGCGGCGTGTGCACTGCAACGTACGGTTGGTGGTCT