Description :
From Genome Similarity Track
Location :
Scaffold_4118:1378- 2471
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4118-snap-gene-0.1Conserved gene of unknown function

Sequence
1093 bases(100 bases per row)
GATGGGAAACGCAGCGTCGACGCCGCCGCCGGCGCAGCCGCCTTGGCGAGCTCTGCTGGACGCCCAGGCGGTAGCGGACACGATAGGGACGCTGCAGCGT
CAGGTCACGAGTGCGCGTTCCCTCGCGCTGTATGACTCGCTCGCGAGCCACGTCGCCGACGCCACGACGGGCGGCGTGGTCTTCTGGCTCGGTCTATCGA
CCTCACAGGTTTTCCAGCGCGCTCTTCGAGTCGGCGCCGCAACGCCAGTGGCCGCGAGTATGATCGGTACGCTCGCTGTCGCGTCGTCGTCCGTTCTGGC
GCTCCATTTTGCGTCGTTTCCGCGTGAAGTCGGCGAGAGCTTCATGCTCACGAACGGAAGCTTCCAGCCAAGCGCGGTGGTGAACGCATCGAAAGAAATC
TCAGCAAAGCTCAAGACGAGGATGGAAGACTTAAAGGACCCGCCATTTCCAGTGTACATGGCGATGGNNNNNNNNNNTTCAGCAAAGGTCAAGACGAGGA
TGGAAGACTTGAAGGACGCGCCGTTTCCAGTGTACATGGCGATGGGTGTGCTGAGCTTCAAGATGCTGGGCGGGCGCATGAGCTCGCTCGCACCAAGCCA
CTACGCCAACCTCGGCGCGTTCCATTTGAAGAAGGCGTCGCTACCCGCCACTGAGGAGTACGCTGATAGCGTCGGTCGTGGTATTATCCAAGAGTTTGGG
CGGCTGTACGGGTGCCACACGTGTGGCATCAAGCGTGGAGTGCAGTACCACGCGGACCACATGCCTCCGAAATTGTACGTGACTGGATTGATCCGATGAC
GCACCGACCTTGGTGCTCACGGGGATGACCTGTTGCTCTTGTAGCGTTGCCAAGAAGATGAATGAAGCGTGGTGGCGCCGACTCACGGGCACAAAAGTGC
CGTTTCGTTTTTATCCGCAGTGCTCGCCATGCTCGAACCAGCAGGCGACGGTCGTCAAGATGGGGAGATCCGACTTGAAGCTGCACTTGTCGGCTCTGCG
GCTGTACCACACGACAGGATTTTGGCTCGTTCTCCTGTGCACGGGTGGGCTTTACGTCGGTGGATCTTCCTTCCAAGGTACGTGGCTTCAGCA