Description :
From Genome Similarity Track
Location :
contig_6:137782- 139686
Transcript NameFunction/comments
g1782.t1hypothetical protein F441_16372

Sequence
1904 bases(100 bases per row)
GGCTGGGACGTTGCCGAGTGGCGCGACATCATCACTCGGATCCAGGAGATCGCCATGGAGGAGAACGACGGCATCCCGATGGTGTACGGCATCGACACCG
TGCACGGCGCTGGTTTCGTGCTCAACTCGACAATGTTTGGTGCCCAGCTCAATGGCGCCGCCACGTTCAACCCCGACCTCGTTTACGAAATGGGTCGCAT
CGGCGCCCAGGACACGCGTGCTGCCGGCATCCCCTGGGTCTTTGGTCCTATCCTCGAGATCGCCAGCAACCCGCTGTGGCCCCGCACCTACGAGACGTTC
GGTGAGGACCCACACCTTGTGTCGGTGATGGCGGACGCCGTTGTCCGAGGTCTTCAGAGCGACAACCAGACAGCGGCGTGCATGAAGCACTTCGTGGCCT
ACTCTAAGACAAATACTGGTCTTGATCAAGACGGCGTCACGATCTCGGACTTCGACTTGCTGAACTACTTTGTGCGGCCATTCCAGGCTGCTATCAACGC
TGGCGCACTCACGACGATGGAGAACTACATCTCCATCAACGGCATCCCCGTGATCGGTAACCACCGTATCCTGGAAGTCCTTCTTCGTGAGGACCTTGCG
TACGACGGTATGGCTGTGAGCGACTTTGGTGAGATCGGTTCGATGAACAACTTCCATCGCGTGGCTCGTGACGCTAACGAGGCCGTTCGTTTCTCGTACA
CTCACACGGGTATTGATATGAGCATGGGCTACGACACGACGTACCTGAACGGTACGAAGCTTCTGATTGAAGAGAGCCCCGAGTACTTTGACCGCCTCAA
AGATTCGGCTCGCCGCATCATCAAGCTGAAACTTCAGCTGGGTCTGTATGACAACCCGATGCCTGGTGCCGATGACGTTGCCCTTGTCCGCAATGACGAC
GACGTCCAAAAGTCTCTCGACATGGCCCGTGAATCCATCGTGCTGCTGCAGAACAACGACAGCACGCTGCCTATCTCGAGCTCGTCTTCTGTGTTCCTGA
CGGGCCACTCCGCCGACAACATCGGCAACCAGTGCGGTGGATGGAGCGTCAGCTGGCACGGATACACCGGTAACGACAACTTCCCGAATGGCATCTCCGT
TAAGGAGGCCATGGACGACATTGCTGGTGATAAGGTGACCTACTTCAACGGTCTCGCCTCGGACGGTAACTACTCCGATGCCAACATGACCACGGCCAAG
CAGTACGCCAGCCAGGCTGACTACACGATTGCGGTCATTGGTGAGCACCCGTACGCCGAGAAAACCGGAGACCTCAACGATCTGGCACTTCCCGCCGGTC
AGATTGAATACGTCAAGGAGCTTGCGTCGACGGGCGCCAAGGTGATTGTCGTTCTGTTCGGGGGCCGACCGCGTCTGCTAGGAGACCTCCCGGAGAATGT
GTACGCTGTAGTGAACGGATTGCTGGCCTGTGAGCAGGGCGGCAAGGCGATGGCTGAAATCCTCTACGGACAAGTGAACCCGAGTGGTCGTATGCCAATC
ACTTACCCGAAGGACCCCGCCAACATCATGATCCCGTACAACCACCGCGTTTCCACTGAGTGTGCGGACTCGAACTACTGCGAAATGCAATGGGACTTCG
GCACGGGACTCAGCTACACCAGCTTCACCTACTCCGACCTCACGCTAGCAAGACCAACGTCACGTCCAGTTCCGACTCCATCGACGTGTCTGTGGTGGTG
ACGAACTCTGGCAGTATGGCAGGCAAAGAGACGGTGATGCTGTTCCTGACGCAGCCGTACCGCTCGATTTCGGTGCCTGAGGTGAAGCAGCTCAAGAAGT
TCTCGAAGGTCAGTCTGGAGGCGGGTGAGTCACAAACGGTGTCGTTCACGCTGACGGCAGACGACTGGAGCGTGTACTACCCGCAGATCGGCAACGGCTT
TAAG