Description :
From Genome Similarity Track
Location :
Scaffold_554:13774- 16832
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_554-fgenesh-gene-0.4P-type ATPase (P-ATPase) Superfamily

Sequence
3058 bases(100 bases per row)
TCCTGCACGATCTGCCACGGCTGCGGCTTGAAGCGGCGCTGGATGGCCGACCACGAGAAGTGGCGCAGCAGACAGAGCACGACGCACATGAGCACCACGA
GCCAGTACGCGGGCTGATTAAGCGTGTTCTGCAACGCGCCATAGTCCGTAGGCGAGAGCGTCGCCAGCGAGCTCGTGAGCAGCAGCGTGCCCGGAAGGTA
CATGACCACGCCGAAGAGCGTCGAGGTGACCGACAAGAAGCTCCAGGACATCTGCCACATCACGACCTTGAGGTTCGCGACGAGCACGACGCTCGTGAAC
GCCAGCACGCCGTACTGGAGCAGCGCCGCGTCGCCCCGACCGTGGCGCTCGTCCTGGAAGCCCAGCAGCACGACGGCCGAGACGATCGCTGCCTCGTAGA
CCGCGCTGCAGAGCCACTTGAAGAACGTGTACCGGTTGAAGAGCTCCTTGCGCGGACCCACAAGGTAGAGCTGTGGGAAATTGCGGCTGACCTCCCACGG
CATGTCGTAGTCGAGCACGCCCAGGATGCCGATGGGCAGCGCCGTGTACACGAGGTTGTACAGCTGGAACGAGAACTCGCTGTAGAACTTTTGGCCCGAG
GCGCCGATGCTGAGCATGAAGTAGTACTGCGCGAGCGCCAGGAAGATGTTCTTGTAAAACATGTAGCCCACGAGCGCGGCCATGCGGCGGTAGTTCAGGC
GGCCATGGTGCAGCAGCAGCTTCTCGAGGAAGTAGAACTGCGCGATCGCGTAGTCGCTCGCGTTCACAGCCTGCATGCCCTCCATGCCGCTGATGCCCAC
GCCCACATGCGCGCGCTGGATCATCGCCACGTCGTTCGCGCCGTCGCCGATGGCCAGCGTGCGCACGTCTGGGTTCGCCAGGCGCACAAGCGACACGATC
TCGGCCTTCTGGCTCGGCGACACGCGGCAGCACACGACGCCTTCGCACTGCATCGCGAGCTTGAGGAACTCGTCACGGCATCGGTTGTCCAGCAGTGTCA
CTTCGAGACACTCACCGTCGATCACGACCGCCTGACGCAGTTTGTATCCGCTGGCAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGCCTCCATTAGGTGCGCGCACACTTGGTCGACGGTCGG
GAAAAGCTCGCAGTTGAGCACGACCTGAGCCATGTCGTTGTCCAGCAGTGAGCACGCGAAAGCGATGTTAATGGCGGTCTCCTGCTTGTCGCCCGTGAGC
ATCCAGACCTTCATGCCAGCCTGCATGAGGCGGCCGATCGCGCGCGGCACGTGGTCCTGGAGCTTGTCCTCAATGGCCGTGGCGCCGAGCAGCACGAGGT
CCTGCTCGATCTCGTCCATGAGTGCGTCGATGCGGTTTGGCTGGTCGCGCTTGCGCTTCTCGATCTCCTCGAGCGACGCGTTCGCGTCCTTGAAGCGCTG
GCTCCAGCTCTGGTACGCGTGCTGGTCCAGCCGCCGGTGCGCGACCGTGAGCGTGCGCAGTGCGTCGTCGGCAAAGCTCTCCAGGTGGATCATGGTTGTC
TCGAGCAGCTCCGGAGTGTTCTCGGATTTCGACAAGAGCGGGTAGATCATGTTGTCGGCGCCCTTGGTGAGTAGCCAGAGCTCGCCGCGCGGGTTCCTCA
CGACCACCGACATGCGCTTGCGGTCGCTCGTGAACTCGAGCACGTCCAGGATTTTGAACTCCTGGAGTTCCGAGTCCAAGGACGGATCGACCATGAGGCT
CTTGTTGATCACTCGCACGCGCGCGACGCCCAGGCCGCGGGACTCGAAGCTGAAGCCAAAGTACTTGGCCGCAGACACGAGTGCCTGCTCATCGGGGGAC
GATGCCGAGAAGCGCACCTCGTCGCTGCCGTCCACGACCTCGGGGATTACCGTGTGGCACAGACTCAGGTGCAGGAAGAACTCAGCTTCGGTGTGGCGCT
TGGTACTCGTATCCGCGAGCGCGCGCTCGAGGCGGTCATCCTCAAAGTTCACGTACGGCATCTTGGGTCTCTTGTTGTTGCTAGTGACAACACTATCGTC
ATCCTCGGGCACGAAGATGCCCTTGCGCCGCAGTGTGGCCTTGCCGATCTCGGTCATGCCCGTGCCGTAGGACGCGCCGTTGATCGAGCACTTGCGGAAC
TCCATGACGTTGCACGTGAGCGTACCGGTCTTGTCGCTGAACACGTACGAGATCTGACCGAGCTCTTCGTTGAGCCCCATGGAGCGCACGATCATGCGCG
TGTCCAGCGGCGCGTAGTAGAGCTCGACATCCCAGGCGATGAACACGGCCTGGAGCAGCATGACCACCGACATGGTCACGTAGAGCGATACGGGGATCAT
CTGGTACATGAGGAGTAGGTACTGGCCGACAGTCACGACCCACTGGAGCGCGTACGTGCGGTTCGCCCCCAGGTACACCTGGTCCGCCACGTTGCTGTGC
ATCCAGATCACGTGGGCCGTGGCCGCCACCATGCAGAGCAGCAGCAGGAACAGGAAGAGGTAGATGATCATCTTGTTGACGCTCTCGTTGATCGAGCTCC
ACTTGGGACGCGACGCCACCGAGCTCTGCATGATCTTGGTGTCCGCGCCCGTGTTGAGCACGAGGCCGTAGATCCAGTCCGTGTTGCGCAGCTGGCAGCC
GCGCAGGATCACGTTCTTCATCGCCACGGGTTGTTGAACCAGCACTGCAGTGTCCATGCGACTGTGAGGCTGCGGCTGGGAGTGCTTTGGCTGCCTGGCG
CTGGCTGCCAACAGTGTTAGGATGCCGTCAAAGCGGCCAATGGCCTTGTTCGGGTTCTCGCAGCGCAGGTATCCCGAGAGCTTGGCCACCTGGTCCACGC
TCTGCGTGTGCAGCGTCGCGTCGCACGCATGGCGCAGCTTGAGGTTCGTCTCGCCGTC