Description :
From Genome Similarity Track
Location :
Scaffold_94:137727- 140296
Sequence
2569 bases(100 bases per row)
GTTTCGTCGTTCTCCTTCGTCTCGCTTCCCGGCTTCGGTTTCTTAGCGCGAATTCTCCTCTTCTCCGGCGTCATTGCGTCGACCGCTCGCCCAGCAGCCA
CTGCCACTCGTAGTGCCCGTACGTGATCACAGCGTCGTACGTCGCCATTCGTCCTTGGCACAGCATGCAACGCCCGCTTTACGATCAGCCTTAGCACCCT
GGCCCGTTCTTCGCGTCGTTCCTGTAGCTCGCTCACCAAAATGCCTTGTACTGCTGCCAAATGCACCTTAGCTCGGCGCTGTCGTCTCCGTTCTGCTGCC
GTCTTGCCACTGCCAAGCGACAGACGTGCTTTCAACTTCTGCTTCTTCGTACGCCCGTGTTTTACTGGCTCCCCATTCTCGTCCGTAGGTTCCGGCACCG
GCATACACCATTCTACCTGCCGTTCTCGGGATCCTAGCGTTATCTTACCCTCGTCCAACGTCTCCTTAGCTTCAGCCACTGCGCTAGCCGCGCCGCGCTG
GCTCCCTGCTCTTCCACTCTTCCCCTTGGTTCATGTACCGTTGCTTCTCACGCCGGCACTCTTCCCCTGGGTCAGAGTACTGCTTCCTCCAGCAGACACG
CGTACAGCACTTACATGATCAGCCAGTCGTACGTGGCCGACCAGTCCTACGCCGTCGCCTGCTCTTTCTTCGGGGTAGTCTTCGTCCTGCGACAGTAAAG
CCCCCGCCTTCACTGCTGTACCTAGTTTCCCGGTGCCGTTGGCGTCGCCGCCGCACCACTGGTCTCCGAATTGTTCGTCGCTGCCGGCTTCGGTTGTCGC
GGTTTGGCTGCTGCCTCTTCATCAGCGATTCTTCTACGACACTCGCGCCACCAATTACCAACCTTGCCGCAGTAATTACACGAAGACTCCGCCTTCCTCT
GCATGATGGGGCGATTGTCTTGGGGCCCATAGTTCTCCAGCCCGTTGCCGCCACCGCGTTCTCCACCGAAGCCGCGTCCGCCACCGTAGCCTCTTCCTGC
GCCACCTCTTCCTCCACTGGTAAAACGGCCGCTGCCGCGCTGTTATTATGACCCTTCCATCCTGTGCTGGCTGTTGCGGCGCTCTCCTGCTGTTGGTTAC
CGGTCGCAGAGTTATTCTCGGCCTTGATAACCTCCCGTGTCTGCGCTGACTTTAGGTTGCCAGAAGTAACTTTGGCGCTCTCCTTCCCCACCCGGCTGAG
ACAAGCATAAGTGCTTGGAGAGCGGCCAATGAGAGGGGGTCCTTCTTAGCGGCTTTAGCCAATCCACTCACTATATTTCCGTCCGTGTCGAAACTCGGTG
GTTCTTCGCCACCAAATCCCAAACCCAGCTGTCGCCAGTCAGGTTGCTCTGCCGTCTCATTCGCCGATTTCTTATTCGGAGGTGACACGCCGCTTTCTTC
GCCGTACTCCCGATTCTCGCGGTACCGCGCTTCGCTACGCGCCAGTCGGTAACTTTAAAACCTTCGCCGTACTCACCACACTTGTCCTCCGCGAATTGTA
CAGCTTCATCCAGTGTTTGAGGTTCGTGAGCTCGTACTTGCGTCGCCGTCGTCTCATTATTAATGCCGTTTATGAAAGCTTCCACGTAGGACTCTGCTGG
GACTCGCTTGCCGAACCCGATGTTGGTTAGCCTGGCGGCGTAGTCGCTCAACCCTTCACCTGGTTGCTGCACCCGTGATGCTAGTCGTTGTTGAATCCGG
AACATGTTGTCTCGGCTTCCGTATTTCTTTCTCATCTTCCTCACCAGGTACGCCAGGTTTCTATTCTCGGGCTGCATGTGTTCGGTCAGTGTGATTAACC
ACTTACTTGCTGCTTCCTTCAGGTGTGCAGTTGCCCCGTAGTACAGCTCTTCAGTCGTCCACGAGTCACCGCCCAGTCCGGCTTGTCGCTCCACTTCCTG
TGGAAATGTCGCTAGCCATGCTTCTACTGATTCACTCGCTTTACCGCTGAAATCGTCGATGTGAAGTCTCTTCATCTTGCGCCGTCGTGGGTTGTCGGCG
TGAGGTGGTGCTTGGATCACAATGGGTAGCTGCGCTGGCAGCGCAGGTGCTGGTACGGGTGGCTGCACCTCGAACCGCTTCATCATTGCTCGCTGCTGCC
CAGGCGTCAGCGCATTTCACCAGTCCATGGCTTCCAGTTCGTCTTCCGCAGACTGCGTTTGGCTCGCCGGCGTTGTTCTCGTCCCTCCTGCAGTGCGGTC
GTTCGGTGATTGCCCGTCACGCCCTCCACCGCCTCCGTCGCTGTTGTTGTTGTTGTTGCCACCGGCGCCACCTCTTCCACCTTCGTGCCCACGCGTTCGT
CGGTCATCGTCTTCGTCTGCGTCATCGTCGCTGCTCCCTCCACTGCCACCGTCGTCTGCCGGTGCAATGGTCACACTGCTGCTTACTCCTACTTCGTCGG
TGCCGCCGTTCCCGTCACGCGTACTGAGGCGGATGCGCGTTCTCGGCTGTCGTGTCTTCTTTGGGGCCACCGGAGTGTTGTTTGCCCGCTTCGTCGTGCT
AGACGTTGGTGTGTCCGCTCTCGGCGTGCTTGATCGTCTGGCAGCTCTAGCTGTTCGTGTGGACATCGT