Description :
From Genome Similarity Track
Location :
scaffold_7:137709- 142349
Sequence
4640 bases(100 bases per row)
GCGATTCCCGTCACACTTGCTAGCACTAGAAGTGATTTCATCGCCGACTACTTCGATGGATTTATCGATGGATGATGGGAACACAACAGGCGATGGTCGT
CCATGGATCAATAGGGGGATATATTCATTCCTAGCATACTCGCAGTGGGAGTGTGTGGTGAAGCTGCTAGTTTTAGTCGGAAATCTTGCGGTCTCCGATA
TGCTTTGATTGGATCAAGTACTCAACGCTAAGgaaattttgctgcgtatgagcaaggaTTATTGGGGGTTTTATCGAAGAATATACCGACGCCGGTTCCG
TCACCTCCTCCACATGTGGTGGTGATACCGTCAGTTTTCACGGAGCGTCCCGTGAAAATTGaggtgaaaagctttcacgagaTAGAAGATTAAATTCTTA
CATTCTGGTAGCGAGAAGTCGACATCGCTAGTACAATAGCTCAGTTTCGTGATGACCGCAGTCAAGTGGCCTTTGCCATGTCGCATTCAGGTGGCCGTGC
GAAGGATTGGGCGATGGCGAGGGAAGTCAACCGCCCTAAATACTTTGCCACATGACACAAGCTGAAAGAGGTCATGAAATCAATTTTACTTATATCAAAT
GTGGCGTTTCAACAGTGGTCAAAGTTCCTATCATGTCGTCAAGACAGCGGCACGTTGTACGACTACGTACAGAAGCTCCGAGAGCTTCAAGCCAGCACGG
CGAGTGAACCACTGCCAGAGGGTGCGTTGTCACGATGTTAAGAAGGGCTCAGTTATGGCCCTCCGAAGAATGTTATCCTTCGACAGAGCTCGACAACTCT
GGAAGATGCAATTTTGCTTGCATTGCATGAGAACTACTGTCAATTTCAAGCATATGTCCAATCGGTCAACAAGATGGAGGCACAGACTGGTGCTCCAGGA
ATTTTGAAACCAATGAACGTTAGCGCGGCGACTGTCCATAGGTAGCAAATTCACAGTTACAGCTTTCAACAATTCGGTCACATCCGCCGTGATTGTCTAA
TGATAGACGAGCCTCTCAATACGGTTCTCGTCGAAATGATCTCGAGTCACGTGGTACTAATAGCACGAGACAGCCGGTAACCAGTAGCCGCAAGGGGGTC
CACTGGGGCAATTATAACCTCTTGAGATTGTGTTAGTAGAATCACTCACAAGGTTTGACCCTTGAAGATTCCTTGTCCTTCGATAACGACACAAGTTCGA
GTGGTCTCCTCGTGGTCACAGCGATGACACTCATCCGTTTAGAGTCATGATTGACTCTGGCGCCACGCGTAACCACGCGCGAAAGCAAAAAGTAGCTGAA
AGTGAATCAGTGCTTTTGTATGCACTAGGCAGAACAACGGTTTATCTGAGTGGAGCTGGCCACCGGTGCGGTGGTCACCACGAAGAAATTACGGTTGAAC
TTCAAGTGAAGCTCGAATATTGTAGCTTGAAGGAATTAATTCAGTACTTGAGATGAACAAACGTAATGACCTGATTTCAGGCACACCGTGGTTTAAAAAG
CACGAGCCATGGGTTGATTGGTAACCCTTTTTTACTTAAAATTTGCTTTCTAGTATTGGAAAAAGATCGAAGGTAATCAAGTGGTGCCCAGAACCGACCA
CTTGAAAAGGAGTGATTCGTTGGTGGGATGGTGATGTGCCTAACGGAATTTAATGAGGGAGAGGTGCCGGTTGTTGCCTTCCTCACGACAAAAGAATATT
TTCGACATTTGTGTATATATGACAATTTTCTCCACTAATACAGTAGTTGGGTCggattgtgggtcagtggGTCTGTGGGTACACCTGACCACACAGGTGA
TGCTCCACCCGCTGTGTGGTTGTTCACATGTGAAAGAATAAACAAATGTTGTTGGCAATGTTGATACTCCCGCTTAGGATGCAGTTAAGTCTGCGGTTCC
ATTAGTCCAGCGTACTACTCCCCATGATGGAAATATAGCATGCGAAAATGCTGGTCCAAGTATTGTGGatgtacccactgggtgtgAGGTTATAAGAACA
GATGTACTTTTGACAATTTTGTCGACGATGGAGTAGCTAGTGCAGCTCGAGGAAGTCACTTACGATGACTTCCTACACAAACTTGAGTGTGATGACTTTG
CGGAGGTCGTGTTTGCTGCGGTCGATGGTCGACTAAGCGGGActacgctcatcatcagttaTGGTTGATTCGGCTCGCAAGGAATTTTGACAGCGGGTAG
AGTCACACATAGGATCGGTTATACTGCAGGTTTTAACTGATCCATATTATTTACTTGTTATGGAATAAAATGTCTTTCCATCCAAACGTGAAGTTCACAC
GGAATTGATACTGAGCCTGAGCCTGGTTCAAAGCATGTAGTGCTTCGGCAGTAGCCACTGTCGCTAGAACAAAGTGAGAACATCGATGAGTTTGTTACTT
GAAGGCAAGCCGCTAAATTGGTAAGGAAGAGCAAGTCCCCTCAAAACGCaccgacgttttgtgtgcgtAAACCAAATGATAAATGGTGTATTGTATACAT
TTTTTACAAGTTGAATATGACAATAATGCGCAGACGATCCCTGCACAAACACCGCTTTTGCTAAAGGATGTCATCATCCAAAGGATGTCCGGATGTACAC
AGTTAAGTATacttgatttggtcgatggatattaccataTCTTGACGAAGGAGGAGGGTTTCCCTTTATCGGCTGTTAATATACCGTCCGGTATTTTATG
AGAGTGACTTGTAATACCCCAGGGACTATCCAATGCGACAGCAACTTTCAATCGATTGTGTTTCGACTGTTACGACGCTTCGCACAAAactactttgacg
acattatTGTCCATTTGAAGGGCGAATGTAGCACATCTGCCGAAGAAGTGCACTCGAAGTACTTCCGGGTGGTGCTAGAATGTATGCGGTAACATTTGCT
GCAAGCGAATATTGCAAAGTGTATTCTTGTGCTAATGAAGTACCGGTCCTCGGTGATTATGTTGGTGATCACGGTTTTCGTGCAGACCCTAAGAAGTTCA
AAGCAATCTTGGAGTGACCGACGCATCGAAATCATAGGGATTTGAGGAAATAGATTGATTTGTCCAATTACCTGCTTATGTAACTACACGGATATGGTAC
TGCACAAAAATGTACCATTGAGTAGAGCATTCgttcaaatcaagaaaagcTTAACGAAAGCACCGTTGCTTGCTTTACCAGATAATACGAAGCCGCATAG
CGTTGTGTGTGACGTTTTTTTAGCTTGCAATCGGTTGTGAATACTTGAAAGAGGACTCAGAAGGACAATATCGTGTCGTGTCGTTCAATCGTGACACCTA
AAGTCAGCAGAAACGAACTATCCTGTCCACGACCAGGAGCATTAAGCAATGAAAAATGCAATGGTAAAATACGAGTCCACCTCTTGGATGTAACTCTGTC
AGTCGTCTTCACGGATCACGCGAGCCTGCGTTGTGCATCTCAATCCCCTCTCTTGACACAGCAAGGATTTTGCTCTTCGCATAATACAACTTTAATGTCG
CGTACAAGCTAGGAAGAATGAACGTGCTGGCAGACGCAATGTCGCATCGTCTTCTAGTAGAAGCTAGCTCATATCAGATTTATCGAAGCGATGTACTCGA
TATAATACACCGAGCGTTTGTTGGGGATGAACAGTGTAATCTGATCATCAGAGCACTGTCGTCGAGTGGAATTCCGTGACTAGCTACCTGGTCGCTATAA
ATAATAGTTGCATCGTTATGCATGGAAGAATGATCTTTTTACTATGAAGCTGCACGCGACGACGAGCCACGGATTGTGGTGTCCCGCAACGATGATATAA
AGTGCATGATAGTTTACAAGGCGAATGATACGCCGATGTCCGTAAAATTTGGCCGTTAGAAGACCTACTGCCCAATTTTAGTGGCCCCTTATGTACAAGT
TGGTGGCGcgatacgtgaagacatgCGATGTCTGACAGCGCGTGAAGATCGCACGGCACACCCAAGTAATCTGCAGTTTCTTTTTGTTCGTACTGACTGT
TGGAAGTCAGCTGGTCTCGACTATTATTTTTCGGCTTTTTCAAGAGTGGTGACGgggaatcagttttgctgtagcacgtctgaaagcgtcaatattgata
tctcagctgttgattatgttacgagcattttgatacaataatcattgccgccgcgtcaaactgaTCACAATGGGGTGCTCGTCTTTGCTGACAGACTCTG
CAAGATGATTTGCATAGCTCCATGTAACGAATCCATCGATGCCGAAGGTGCCGCTaaattgttcattgatcatgTGTTTTGCAGTGACTAGTTGCCAGTC
GCCATCGCCTCTGATCGCGAGCCACAATTCAAGAGTAGCTTTTAGAAAGGTTTGTTCCGAATTTTTGGCACTCGCTTCGATGTGTCCACTCGGAGACTGA
TGGGTAAACACAACGTGCCAATCGAGTGGCCGGTGATGTTTGCGAAGTTTCTGTGCAAAACAATTGCGGAATGGAGTTCGATGTTACCATTGGTTGATTT
GCCATGGACAATCCAGTTCACTCATCCACTGAACTTACATCATTTTATGAATGGCTTACGACACCCGCAATTACCTCTTGGTGCGATGGGTGGTGTCTCT
AAGGAAAGTGGGGGGCTTGGCAAATCATTGCCTTCCAAAT