Description :
From Genome Similarity Track
Location :
Scaffold_953:13770- 16410
Transcript NameFunction/comments
Phyta_totarag11519hypothetical protein PHYSODRAFT_505293
Phyta_totarag11520conserved hypothetical protein

Sequence
2640 bases(100 bases per row)
GTACGGTGTGCGATGTCACCAACTGCTCAGTGGGGCCTGATTGTGGTAATCGTTTCCGTCCACCCTACAACCTCGACTTGATCCAGACTCGCGTCGGTCT
CGGAGTTGTGAGCAATGACTGGATTCCTTGTGGCGCATTTATCGTTGAATATGTGGGAGAGATTCTTTTGGAAGAGGACGCCCACCAACGAGCAAACACA
CAATACCAGGCCCAGTTCACTACTCACACGATCTGGGACGGAGGAGCGCGTGTTTTCGTTGACGCAGGAACGTGTGGCAACGAAAGTCGCTTTATGAACT
ACTCGTGCCTGCCAAATTGTGCTCTGTTTGAGAACGACTGGACCAACACGACGCGTCTTGGAATCTTCGCTACTCAAGACATTCCACCGCTTCAGGAGCT
GACGTTCCGTTATCGAGAGAAAAACCAGCGTTGTCTGCACACCTAGGGTGCTGCCGTGATGAAggcactgctgctactgcgtAAATGCTAGTGTGACTAT
GTGCGCAGGTGTCGTTgtggctacatgtatacgtACTGTATGTGCTGTGTACACAAGATGCGGACTGTATGCAGGTAACGTTCATTTCAATGCATTGATT
CAATTGTCGTCATCCGCCAATAATCTGATATGTATCATTTCCTACTGATCATAGCATTTGTGTAGACCATTGTATTTGTCCAGCATTATTTCGCTCCCAA
CAGGGAACCGAATGGCACCCAACGCGGAGTTCCACCATCGTCGCCCTCCACTTACTTTAGTGGCGTGTTacttacttaagtactgCATAGCACAGAGGCC
ATCAGTGTGGCGCAAACTTGGACGTTTCCGGTCATGACGAATGGGAAGCCCACAACTGCCACCAAGTTCTTCATTGCTGCGTCGCCTTGAACTCGTTGTA
GAATTTGGACTACACCGCAAATACGGACTCAAATGGGAACTCCACTCGCAGAAACTTCCCCACAAAGAGTCGCTACATTCTCTTTGTatcactgcagtcg
tcgccAGACTCGAACGCCACTGTGAAGATCACCACCTCTGCTATCACACCGAGGTTCATGGGTTCCCACCGGAAGTCAACCACGCGATGTGACGGAAACG
ACGGTCGCTGAATTCGCTGCAAGAAATCGGTTGTCATCTGTCCAGACTGCGCCTGGACTTCCAAGGTGCCTGCCAAGATCCCAGCAAGCGGATGAGGTCC
TCACCGTTTCTCAAAATGACAGAAGCACTCCTACTTTAAGCATTGAGTTCAACTCCAAGCACCCAAAAGTCTCATACTAGATACACTTACACTTACTCCA
CTGCTTGAATCTCGAACGTCATTACCGACGCTGCTGGGGTCGACGCGCTGAAGGACGTTCTTGACAAATCGACTTTCGACGACTTGTAAAGCGCACTGTT
ACCGCTCGTCTCCGTGACCCAAGCACTGATGGGCGCCACCGACGTAAAGCTAGCCAAGTCGAACGTGACCTTCGAAGCCGCGTCACCCGAGTTGACTGAA
GCGAGCACGAGCAGTTTGGTCGTGGATTCGTAGGCCATGACGGTGTTCGTATCGTCCGTCGAGAGGATGGTCATGCCGGGTGAATGTGGCGCGAGTACTG
TGCCAGCGCGTAGTAGTTCGGCTTGGGCGCGTCAATGGTCATATTTCCTGAAAAGGTTGCCAGTACACGAACGCCGACACACCCATCTGGTTGATGTTAA
TGCCAACAACCTCAGCCAGGCTGAGTCCTGTCGCGTCCTTTTCGCCGTACTGGGAATCACAGAATTTCTCCTTCGACTAGTAGCTTCAACGGCACTCGAT
CCGACTCACGGCTACAGAAGCCGTGAGTGTTGATTTTTCCGATTGTGACCATTACGTCGGCATCCGTTGGCATGGAGTTGAGTGTGGATAGTGCCTGGGT
ATCCAAGTTTTCATTACTCGCTGCGATAGACACGTCTTGCAGTCCGAAATTGTCCAGCTTGAGCGTATCAACTTTTAACCACAAATTGCAGCTCCGCGAC
AGCGATAATTATTGGAGCAGCCAAATGGTGAGGGCAAGCTCGGTATTAACCGGTATAGATTCCGGTTCCACAGAAACGTAGCCATTCTGCGGCTAATTCG
CCACAATTTCTTTCTATTTCTAAAGTTTTCTTAACATAGTGGAAGCAAGTCTGCAAGCAGTCGCCGTGCGAGCACCATATTTAGAGCTGCAAATCACGCC
CACACATTGGCGCAAAACCTCCAACTTTCCTTACTTAAGTATTGATCGAGAAGGCGCGACGTATACAAAAACGATACTTAAACGCGGAAAACGACCTTTC
AGCGGTCAGTCAAGCACCTTTTCATTATGACAAGGTATCGATAAATATCGGTGGCGGCTCTACAACTGTTACCGACTACGACGAAATGCGAAACTACCGT
GATGCACCACTCATAGAGCTCGGATAATTAGGATATCTAATCGATGAAGTTGGGACCTACGTTTGAGCACTTTCACAAATTTGAAGTCGTCCCATACGAA
TTTGGGAGAATACTGAGATCAAGTGATAACGCCTGCACCGGCTGCGCCACACAGTTTTAAACCATAAAAAGTTGCTTCAAACCCACTCTTTTTCAAAAAT
ATACCCGGTAACCATTTCTAATCACGGTACTTAAATGTCA