Description :
From Genome Similarity Track
Location :
Scaffold_324:13770- 15066
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_324-abinit-gene-0.37Sodium/hydrogen exchanger

Sequence
1296 bases(100 bases per row)
TTCTTCTCCAACTTTTCCACGATTCTTCTGCTCGCTGGTGTCGGCACACTCATCACCATGTTTGTCATTGGCGGCATGCTGCTCTGGCTCGGCCAGATTG
GTCTTATCACCAAGCTCACGGCCGCCGAGGCGTACATGTACGGTGCGCTCATCTCGGCCGTGGATCCTGTGGCGACGCTGTCGGTCTTCAAGAAGAATGG
CGTGCCGCCGTTGCTGTTCAACCTCGTCTTTGGCGAGAGCATGCTTAATGACGGCGTTGCGATCGTCGCATTCACGCTGTTCCAGCGGCTCATCAAACAA
AAGATCGAAGAGGTCACGCTCCACGACCTGAGCGTGGTCATCACGAAAGTGTTTGGCATTGGCTTTGGCTCGGTCTTTCTCGCGGCCGTCGTGTGTTGCA
CCTCGGCCTTCATGCTCAAGCAGGCCGACCCCGTGTTGCGGCAGTACCCGTCGTACGAGATCTCGATCGTGCTGATCTCGGCGTACCTGAGTTATGTCGC
CGCCGATCTCGCAGGGCTCAGTGGCATTGTCGCGCTGTTTTTCTCGGGCGTGTTGATGAGCCACTACCATCTCTACACGATCGCCGACGAGAGCGCGACG
GCGCTTCGCCACTTGCTCTCGACCGCCGCATTTGTCGCTGAGAACTTCATCTTCATTTACTTGGGCATGAGCGTCGTCGCGTACTCGGGGTACTTTACGT
GGGACTGGGGCTTCATCTTCTTCAATCTCGTCGCGATCTTGCTTGCGCGCATGCTCAGCACGTTCCCGCTCTTCATGGTCGCCAACCTCAGCCGACGCGA
GACGATTCCGTGGAGCTACATGGTCGTCATTTGGTTTGCCGGCCTGCGAGGGGCCATCGCGTTTGCGCTGGCGCTCAATGTGTCGACGCCGGACCCGACC
CACTCGGGCGTGATCCAGAGCACGACGCTGTTTACCGTCATGTTTACGACGCTGGTCTTTGGCATGGGCACGAGTCCGCTGCTTCGCCACTTCAAGCTCA
CATCGCAGGACAACGACGAGTTTGGCGACATGGACGAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACAGCCCACCGCCGCTTTGACGACCGTCTGGACGGTGACTCCA
TGCTTCGCTCGCGCTCGCGCTCGGGGATCCACGGCATGTGGGAGCGGCTCGACGAAAAGTACCTCAAGCCGCTCTTCGGCGGCCAGCCGCGGGACG