Description :
From Genome Similarity Track
Location :
Scaffold_2281:1377- 2904
Sequence
1527 bases(100 bases per row)
GCGATGAATCCACCAAATCCTTGTTCAAAGAAGGAGATCAAGTCTGGTTGTTTATGGAGCGAGTCAAGTCGGGCCTGACCAAGAAGTTAGCACACCGATG
GCATGGACCATTCAGGGTGAAGAAGAAGGTGGAAGAATTCGCCTATGAATTGGAGTTACCCGACAAGAGTGGATATAGGTTCTACCCAGTGGTCCATGTA
TCACGTCTGAAGGCAGTCACCGAACTCGGCGGAAGACCAAAGACGAGGCTAATCGCCGACCTCGAAGAGACTCAGCGATTTGACTTTGATGAAGAATTAC
TGCCTGAAGACAGCTGGGAACCAGACACAAGTACAAACCAGTATGAAGTCGAAGCAATTCTCGACGATGAGCTACCATTATCCACAAGTACGTCACGATC
ACAACGGAAGTTTAAAGTTAAGTGGGTCGGCTACGATGAGCCTACTTGGGAACCACTGTCGAATTTGTCATGTGGGGGTCTCCTGTTTGACTATCTACGA
CAGAAGAAGCGCGAAAACCGTCTGCAAATGGTGCAAGTTGCAGATGAGGATTAGCAGCTATTGCACCAAAAGTTACACCAACTCAGCGGACGACACAGGC
CGAGTTGAGACGGAATGCTACTGTGTCGAAACTACATATACTGAATAATTACGAAATGAAGTCCTGAACGATACCTACGGGACGCCCAGTCAAAGGAAGA
AAACTAAAAAGTCGGCGATTCGGATTCCAAGTTAGTTGAACCCGACGGAGACAACTGGGAAGAGCTCAGCGGACTCGACGATTGGGGGCGTGGCGTCGTA
GCAGACGTCATCCCTTGGGAACTTGCGGAAGGAGATGCAACATTCGCAGCCGTGGCAAGAAGTATAATCGCCGAGCTAGCCAACGAAGCTGACGCCGAAC
CAGGTGCCTCAGGACCCGACGCGGCGGAAGTGGGCTGAGGATCCGTTCCACTGGGGAGTGGGGTGCCGAACGGAGACATACTCGGAGACGCGCCTCGGAG
ATTGGGAGAACCCAACCCATCGTCCGCCGAGTCGTCATCAGACGCACTCTCGCCATCTGAGCCGAGCTCACCGATCGAAGACCCAGTGAAGATATGGATG
CCTTGACGATTCAGCCGAGTTGGAGCACCCGGGGCATAGGCAGGAGGCGCTGGTTCAGCAAGATCGAAATCTTCTTCAATCGCGTCGTCAACAACCTGAG
GATCCATACCGCGCAGAGCGAAAACCAAGAAGTCCACGTTTCCGAGCGCGGCAAGCAAGTATTGTACGGATGGACCGCCGGGTCAGTAAGCCAACCAAGC
TCGCCAGGGGCTTCGGCTAGATCCCACTGCGGAGCCACCGGGGACCCGCTTTTTCTCCGGGGAGAGAAACCCCCCGGAGAGTTTAAGCGGAGAAAATATT
GGGGAGCGGGCGGAGGGATCAAAAATTAAACCTCTGCGTCCACCAGTGGAGCAGGTTCATCGCCGAGCTTCTGAGTGACCGCCGAGTAAAGCTGGTCGTA
GACAGCAACAACCAAAGATCGCAAGGT