Description :
From Genome Similarity Track
Location :
Scaffold_111:137692- 140979
Sequence
3287 bases(100 bases per row)
ACTATTCAACAACGACTCGTAGAGCTTCTAGTCCTGGTTCAAGGGACTAATAACGACTCTAAGAATCGTACGCACAATGTGCTCTAGAGTATACGCCACA
AGCTGGCTCTTACTCTTAACGAACTACTGACGTCTAAACTAGACACGTGTCAATCGAAGATCAAAAGGGGTACTGAACTTTTATTTATTAGTTTTATCTA
TAATAAACCTCATTCAACTACCTCATACTAAGGTTAAACTAATTTGCGTAGGGATCTTCAGTATATTAAAAATTGATGGATGATACATCAATCTGTCATC
AATGGATGACTGAGGTTATCAACCACATCAGTTATCACAGATAAAACTTGAGATTGTATATCACATATACAAGGTATATCCCATTAGGACGGTAACGGCA
CGCTGGCGTTTGCTGAGCAGTGCAGCCTGAGAGATTTCCCACGAAATTTCCATAATCCTACCCATCTACGTCCCGTGACCCTCGCTCCCTTTCCGACCGG
TTGCTGACGAGGACTTCAGCCTTGGTCTTCGCCTCATTGGGAGCCTTTGTACCCGACTGCACCATGCCGTCAGCAATAAGATCTCATTCTACAGCTATTT
AGAGCTAAATAAATACTTGTGCGATGTATATTTCCATGCGCTCTGTTTGTAGTTGCGAATCTAGTAAACAATACTTGTGTACATTATACATATCTTTTGA
AACTCACCCCCGATCGCTCCAAGAAGTACTAAAATACAACAATCTGCTGACACCGGCGATGGTATCGGGCAACATACCATTTGCATTCGACGGCTATTAC
TTCTTTCAAGATTTTTGAATTCATTCAGGTCTTTGTACAACCTCTCGATTCCCCAGCGCATTGCAGGTTCTCTCCTAAGTGGCATGGACATGAACCCATC
CTCTCGAATCACTTTGGTTCTTGAGTAAAAGCTCCATCTATCACTATGATAACTGAAAGGTGGAAGAACGTGAAAACCAGAAGTAAGGAATCTGCCATGC
TTTGACTAGCTTAATTTTGGTGAACCCAACTATAACTGTTTATTTAAGATGATCGCAGTTGATGACAAGTGCAAAACCCACCTTCTCTCTTTTAATGTAT
CATTTTCCTTCACACAGACCGGTTCTGAATTGTTGCAAGATTACGAGGCCTTTGTCGAGACTCTGGACGAGATTTCTAAATCTAGGCCCCATGGCTTCAC
TACGGACAGTGGTGGACCGTGCCGGAAGGTTCGCCGACTTGCACAGGAGTAAGGATGGACTTTTGTAAAATAATTGCATTCCAATTGCAAATGCCTAATA
TTCCTTGGTTCGTTTCTCGGCGATTTTCAACGCTCCTTGTTGGTCCTTGCCTAGATCATCAGTGCTGACTAAAGCAGCTCTTAAGTTCATCAAGTTCCAT
GATGTGATGCAGCAGGCCATGACAATTGATCACAAGGTTCAAATTTCTACCACACTCCGTGATTAATTGAAAAGGGGGCAAAGACAAACCGTATCTAGGT
ATGGGATCAATAAAAACCGTTTGTACTCCTTAAGCATCACTATACGGAAGCTTTGTGGTCTAAAAACTTCAATTCAGGTAGAATTTCGCTTAATGGCCTG
CCTCAGAAAAATAAATTGATTGCTTAGCAACTTTTACACCACTATACTGTCCCATTAGGTTACTCAAGTGTGCCCTCCTGACCTTCTTTCATTCTCACCA
ACTATCGTTTAGGATCACTCTGGGCATCCTGGACATGTTCAGGGGTCCGGTCTATCTCATTAAAGCCTTGAGCGAGACCGAAACCGTCTCCATCGGTCAT
ATAACTGGATCGTTTTTCGAATCAGCGAGAACACATAAATAACACCTGCAGACCGAGACAAGGTCCTAGCTTCGATCTGCAAGCGGCGATAGACGCTGAT
TGAGGAAGGACCACCACATCGTGTGCTGGGTTGTTGACTCCCATTTCAATCAAAGAGAATGTCTCCAGCAGGAAAATGCGGCCTGTATACATTTAAGAGT
GAGATACTGTTCAAGCGTAAGGTTCCCGCGAGTAGAGTGGACTCCTTTTGCGACCCATCATGCTTAGTTATGAATTTCTTGGTTAAGTTTTTTTCCTCTC
TGGAGAAGGAATTCTCGCCGCAAAAGATGAAGCAGTCTGGGCTTCGTACATTGTCAAGAATCAAGTCCTCTTCTGGGAGAATATGAAATCAGGTGCCCCG
AAGCTTGCTTTGCAGTGAAAATCTATTTCACGCATAGTGCAGGGTTCAAAGTTCATGGTGTTCTATTTCCAAGAGTTGTAACCTACTCGGCATCTCAACG
TGTGATAAGATGGAGAGAATCGAAATGTTCTACAACAATACAACCCACAATCATCTTAAGGCTGCATAGCAGAAGCTGTTGCTAGCGCCTGACGATTTAT
TCCCAGTTTAGGTTGACTTGCTGGGGGATGATAACGACTTTATTGTACTGGAAGACGATGATAATCGGTAAGCATGGCTATGTAGGAAAAGAGGGATTTG
ATGATAAGACCTGACGAACCAAAGTTTTATTTCCAACCCGGCAATGACAGACGCATTGGTGACCTCGGCATTATTCTCTGGCAACTAGCAAGGTTTACTT
CGGCTCAATGCTCCGGAGGATGTTACCGGTAATATTGCGGCCGACCAAGAAGACATTGTCCGCGAAGACACATTCGAAACTTTTGCCGGCACAATAGGGT
ATTCAATAACAGCTGCCTCAGATCGGGCATAGTGTATGCAGATCTCTTACCTTCTGCATAGCGACCAGCGAGTCTTCTATGTCACCGTTTTTTCTTCGTA
TGTTAATGGATTTTACCCGGCCGGGCTGCACTACATGGACAGATTCCTGCCGCGTGAAAACTAATAATTTCTTTTAAAACGGTGAAAGTTGGGCGAAATA
GTAATAAATGGGGGGAAAGCGTTAGGAGATGGTAAAAAACGGTAACAACTATGTAATAATTGGTCAAAGCTGTTAATACCTTGGCAAAAAAGGTTAATAC
TATTAAAAAGTCACAAGGAATTTTACCCAACATCCCTACCACAGGTAGTACAGGTATGTCGATCGTAGCACAACTTTCGTTCTCAAAGCGGAAAACGGAT
AAGCAAATAAGCGTAAGCACGGTACAAACGTAGTTTGAAATTCACGATATCAATAAGCTCGTTCATCGGAGACGAAAACACGTTGGGATTGTCTTTGGGA
CTGACTTGCTCAGCTCTTTTCGTTGGGGTTTCCACGCGTTAGGTGGTATACGGCTATTTAATTGGGGCAATCCCATACAAGTCCTGT