Description :
From Genome Similarity Track
Location :
contig_50:137631- 160833
Transcript NameFunction/comments
g10369.t1hypothetical protein
g10370.t1hypothetical protein

Sequence
23202 bases(100 bases per row)
GCTCTTGGTTGGCTGATTCCGGAGGCCTGAGAGTCGGCCAAAGACGTCGACTATTTCCATGACCCTCGTTAGCATACTGGCCTTTTCCAGGAAAACTGTT
GAGTCATCTACAAACGCCGAGAACGTGTGCTCGGCTGCCGGTGTTCCTGGAACTCGGAGGCCTTTGATTTGCCTGTCCTGTTGGATTGCTAACGCTAATA
TTTCTGCCGCGAGCAGAAACAGAAGTGGTGCGAGTGGACACCCTTGCCTGATACCGGATACGATGTCGAGTGGCTCGGACAGGCTGCCGTTAATCAAAAA
TCGTGCTGTCGTTCCTTGATGTAACTTCCTGATCATTACTCCGAACGCGTTCGAGAATCCGAACTTTTCCAGTACTTGGAAGAGGAATGCTCTGGCCACT
GTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCAGTGCTGCTAGGTCGGGTTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATCA
TCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGACTCTCCAATTGTACGTCCCATCACCTTTTGAACCCGGGATGCTATGATCTT
CGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCCATCGCGTTGTCCGAGTCTCCTTTCTTCCTCAAGGGAATGATGAGCCCTTCG
AGGAAGGATTTTGGTGGTTCTCCTCCTTTTAGGAGCTCATTGCCGATAGCCACCATAGCTGGCACGAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTGT
TGAGGCCATCCGGGCCCGCTGCTTTATGCCTGTTCAACGCGTCAAATGCTTCAATGACTTCATCCGTCGTGATCGGCCTCATGAGGAGCTGGTTTCCTTG
CTCAGTGACCTTTCGCTCTGCCGGTATAGTGACAAACGCATCAAATTCTGCCTCCATCGCTTCCGACTTGATTTCATTGTGCTCCTTTCCTAATATGGGT
TTCCATTCCGATCCGAAGCGGTCAGCGATTGTCATCTCTCGTGTGAACTCCTTTCCATTGAGTCTACTGATCGTTGAGATGGTCTGATCTCGCTCCCAGT
TTGAGACTCGTTTGTAGTTCCAGCGAATTTGTTCCATTGAGCGCTCTAACCACTGCGCTGTTCGCACCAGGTGCTCCTCCTCCTCCGTGACCGCGATGAG
TTGTGATCTGGTCATTGGCTGTCCTCTATTTTGAGCGGCTATCTTGTGCACCAGTGTGTTGCGCCGTTGATAGTCTCTGCGCTTCACGTGTTTGATGCAT
TGTACGCAGGTTCTTGCTTGATCATCCCAGTTGGCCACCGTGGTGTTCCTTCCGACGCCCGCCTCCGTTAATTCAGTGAGCAGCTCCTGTTGGACTCGTT
CTGGTTGGGCCGTCCTGATCGGGTAGGTTACCTTTTGCCCTTGCCTCCTCCGTTTGCTGCCTACCGGTGCTGCGCTCCAGTGCAAGCTGACTCGTTGATG
GTCGGTTGGCAGCGCTGGTTCCTCGACTGATACCCATTGTACGTCGCTGACCCAAGATTGAGGGACGTAGAAGCGGTCTATTCGGCTGGCCGTTTCTGGG
CCCCAGAAGGTGTAGAATTCGGTTGGCTCCGGGTCTTCATCCGTGTCTTCCACTGGATCCACCATTATTCGGGCATCCTCTAGGTGTCTACCTGTCACGA
AGTCCCGTAGCGCTGCTGATTCCGGTCTCCCCGACCTCTGGCCCCCTAGTCGATCTAGTGTTGGACTCTGGACGCTGTTGAAGTCCCCTGCAAGTACTAC
GTCGTTATCCGGCCAAGCCCAGTCATTCAGGCTTCTGAAGAATTCCTCGCGGTCTGCGTTCCCATTTGGCGCGTATACGTTTACCACGAGGGCTTCGTCA
ATGCGCACCACGATCACCCGACTTGACCAGTGTTGCTGGAGCGCTGGCCGCGCGGTTTTCGCCGTGGCTGGTGTTAGCAATACCGCTACTCCTCCTGATC
TGCTGTCATTTGTGCTCCAATACGACATCCTGGGGCAGTCTCTCGAGTTTTGTTGCCCCCATAGTCTCCTCCAGTCCTCCTCCAGTTTGGCCGCTTCGTC
CAGTGATCCCACATGCGTCTCTTGTACTAGCCACGCCAGTGGTCTCTCCCTTACTGGGGTCCTCCTCCACGCCGCCATCCACCTTCTTCTACTTTCCTCT
TTGAAACCCCGCTGTCTAGTCGTCGCTGCCCGACTTCTGGCTGCCATTGTCTCCTCTGCGGTTCCGTCCTCCGCATTCCCCTTAAAAATCGTAAACGTCC
GTAAACGTCTACTGCCTCGCCCCCTACTATGCCGTCCGGAGGCGAGACTTTGGCCTGCTCCGCGCAGCCCTTAGTACTGGTGATTTTGAGCTTCCTCTCC
TCGTTCTATAGTCGAAGAGAAGAATCGCGCCACTGCAACCAATCTAGGGAGTGTTTAGTCGTTGCATAAGCCGCCTTGTAGCCTTCATGGGTTCGTAGCG
CTTCGAGGTGTCTCGTCAATCTCGCGAGCGCCCCATTATCGTCCTCGTCCTCCGAGCCCGTTAGGATTCTGATTTCCTGGTCATAGATCACGGCACATAG
GAGGTGCTGCGCGAGGCGTAGTTTGTTGCCGATGTCGCATAGTTTGAGAACTTCATCGTTACCGTATCCACACGCCCGCATCCTGACCCAGTCGTCTCGG
TTGTGTATCAGCGGCGGTAGCCGAGATTCCCGCAATGGGAATTTACTTCTCCACGCATCGATCCACCGATGCACCTCCGGGTCGTTCGTACGGTCTCTTA
AGCGCCTAATTGTGCATATAGACACCCCCGTCGCCATCCTGCTGTCCATTCCTCTAGAACTTTCTCGCTGAGGGAGGTTAGGAGCTCCTCTGGATATGGA
AAGCGCTGCACCATGTAGAGCAGCTTGGACGGCTCCTTTTGTGCGGCTTGGATCCATTCCTGCGTCGGGCTTCGATCGAGTGGTAGTGACACTTGCGCTG
TTTCCGGCCATTGTTGGCCTAACTTCTGCCATAAATCTGGCCATGCATCTCGGGTCATAAGCGTCTCCGTTGCTGGCTGCTCGGCGATGTCCTGCATAGA
GACTGCGCTGGCAGTGTGCCGCTTCGTTTCCTCCTGGGTCCGCATGATTTGCCGAATTTGTTCTCCTTCAATCGGAGTGGTTGAGTGATTACGCTTCTGC
GTCCTGGCCTCCTTGGTTGCCCTTGTCGCGGGGACTGCGACCTGCTCGGCACAATCGAGCTTTGGAGGCAGTGTCGCCGGATTACGGCCTTCGTTCAAGC
TACGATGGCGCCGGAGCATAATCGAACAGTGCTTGGTTGATGACAGAGTTGGTAAGGCGCATGCCACGGGCCTATCAAGGTCGCGTGGTGACGGCAGAGA
CGATGAGGCGTGTCGTGTACGGTACTATTGGCCTCAATGCACGTGACACGATGCGTCAGTGGGCGGAGGCACGCGCTCAACTGCATGAAGGCGAGCAGGC
CGCAGGTAGGCGAGCAGCTCGCAGATTTTACATGATAGCTTTTCCCATTAATAAACTTTCCTCTTTGGAAAACAACCCCGGGTATTCGCGACAATGAACC
ACTGCTCATGACAAGCTAAAAGGCAGGTATTGTCTTCAATATAAACGCTAAATCGCTATTGTTTTAACCCTTTCGCGGTACAAGGGTGCATTTTTCGCCC
TTTAAGGCTATTGACAAAATACGGTGAGAATGTGCCTCCTTAAAGGGCGCATTTTGCGCCCTTTAAGGTCCCTCTTCGAATTCGGCTATCGTGTATTGTT
ACTACCAATCAGAGCGCTTGGTACAAAAATAATACGGGTAAATTTGGGCATTAGCGGTTATATTTCCAGTTGTGTCTGGTAAGTACGAAGTATATTGTGC
CACGTCGCCGTCACTTGAACATAAAAACGATAAAATGGACGTCTTCGTGCAACGTCGCCATGAACATGTCGCCAAATAGTGGACATAAAATGAAATCAGT
GCATATCGCCCCCCCCTTCCGCCCATCTTCCCTCCCTCCCTCTTCCAGTCGATTTCTACTATACTAAAAACAAGTTTCATACACCCTTCTTCTATCTTTG
GCCATGCGCACGCTATTCGAGGACTGGGAGGATAAAGCCCTCGTCCAGATTGCATTTCAGTTTGAGCGCGAAGGAATCCGGATCACATGGGACTACGTGG
CACGCCGGTTCAAGAAGAAGCGGACTGCGCAACAGCTACGCTTGAGGCTAGCTAGCCTCAAGCGCACGTATGGGAGGAGAATCGTAGACTTCCCACCGTG
CTTCTTTTCCAGTGTCGCTCGGGGACGACTTTTGCGAGCAGTACCAGAAGTTCGACCTCAACTACCAGTCTGTCGAACACGAGCAGCAGGGTCATCGCCC
GCTTATCCGATGACTGCGAGTCCAGATCAAGCAGCGATTTCCCGTTCTTCATATCTGCACTCCATGCTGACGCCGACTGAAGCGTCTCAGGTAATGGCTT
CCCTTTTTGGGAGCATCAGCGCCGGAGATATACGGCAGCCAGCAGGTCGTGTGCACGACAATGCTGGAGAGATCCTCCCTCCAGGTGTCTCCACCATCGT
TGGCGCTGTAGGTCCCGTTGGTGTCCGTGACGTCTTCCTCGATGTTGGGTCAGGAATAGGCAATGTTGTCGCCCAAGTCGCGCTCATGACAAGTGCCCGC
GTCTGTGTTGGAGTTGAGCTTCGTGCCGAGTTGTGCTCACTTGGTCAAGCGTGTATTGAGCGCTATGCAGCCTCTCTACCTCAGCTTCGCAAGGTGTATT
TGAAGGCCTCAGACGTGAGAGATGCTGCTCTGTCATCACAGGCTCCCACGTGCGAAGCAACCATCATCTTTGCGAATATCTTCCTCTTTGAGGAAGATGC
TAAGTTAGTCGTCGCGCGTGAGCTCGCTGTGATGCCAAATGCACGAGTAATAGCAGCAACTTCTCGCTTTTGCCCCAGACACCGTGCTTCCTGCTCGGAG
ATCTTTTGCACTCACTGGTCGTTAGTGCGTGAAGTAATGGCGTCATGTAGTTGGAAGTCGTCTCTTCACCCAATTTATATTTACAATAAAGCCTAAGTTT
CAAACTACATACACTTTCTTTAGACAGCGTGGTCGGCAAGGCTCCTAAGTCGATCTTCATCAGCAGGTCCGCGCCAACGCCGACGCAATCTTCACGAACA
GGGCGGCACTGACGCCGTCACGAACTTCATCAGCAGGTCAGCAGGACGGCGCTTCCCCGACATCAATTCCAGGAGCTGCACGGCGCCGAAGCCGGCGCGA
TCTTCATGAGCAGAACAACGCTGATGCCGCCGCCATCTTCACGAGCACGATGGTGTCGACCCTTCCGTCAAGTTCAGCAGCTGCACGGCACAGACGCCGC
CTCGATCTTCATCAGCAGAAGGCGACCACACCGACGCCAAGTCCACGAGCTGTGCGGTGACCACGCCAACGTCAAGTACACGAGCAATTACACTTACAGA
TGGATTTGACGAGTTGCACCTGGCTTCGCTGTTGGTGAGGTCTCAATTTGGGAGGCATCTTGTCGAAGTTTGGTAAGCTGAGAGTGTCGCCGGATATTGC
CCTTGTCTGTAAACAAGCTTTGAGGCTCGTAGAACTGGTGAAATTTTTCCCAGCACGTCAATTCAATCTGCGGGCACATCCACGGCTTCGCGGCTTGAAC
GTGCACCACTCGACATAGGCACACACTGTGTGTCACGCAGTAGTTAGTTACCTCGGTCGGGTACCGGCCCTCCCATCGACAAACAATGCAGCTTCGGCGT
TTCCTGTTCCTCTCCGCGTATATTTGTTTGGAGGCCACGGAGGCGCACCCACTCACTGCCAGCCTATTGCCTGACTCAGTTTGCATGACTGGGCATGCGT
GGGCTGATGCATCTTCCTCTTCTTCAGCATTACGACTTGTGTACAGCATACGACCTTCGCTAGGCGCTTCAGCCCACTGACCGTTGATGAGCTCGGCCAC
CAATTCAGTGACGAACGCTCGATGGGGATCTCGTGCAGTAGAATCGGGCTTTGCCAGCCGTCGTGTCAAGTAAGCATTCGATCTTGCAACATCTATGAGC
GCTAAGGCAAGTTTCTTATGCCAGCGCTTGTAGGAGTGCCCGTCCGCAATAGAGAATCGTCCTCGAATTTGATCGAGTCTATCCACCCCTTGCATATTCC
TGTTGTATCGAGCAACGCAAACAGGAGCCGAGAAAGCTCGCCTCTCATTTCCTATCATACGGTTTACGGTAGTGGTAGTTGACGCGTCAGCATTCGACAC
CATATTCACCACATTTCCGTCACACCACGAGGCTGCAAGCATGCTATGATCAGAGGAGACAGCCTGCCGGTGATCACCGCGCACGCAATCGTCTTTGTGG
AGGATAGTGTGGCTGGGGAAGTGTTTGCTGTTTGCTCGTATCGTTCCTCTGGCGTAAAGACCCTTTAGGCGAAGCTCTTGGAGCAGCTGAACACTGGTGT
AGTAGTTGTCCATATTAAGAACCCTGTTGGACCCAAAAAATGGTCGTGCCACCTCCAGAACGTGTTGTCGAATCTTCGACACTTTCTCTAGCTCCTCACG
TAGATCCTGTGCCTCCACTTGGCCTATAACACCATGCAAGCGATCGGAGATGTCGCTCTGGTTGCAATGAAGTCTGTAGTTCAATGAAATCCAGGTGCTC
GAACAGCAGATCATGTACAGTCGGAAATGGTACTTCCCTGTTGGCTTTAAGGGATTGTACACGATGAGGTGGCGTCCTTGACGAGAGCGACAAGCTACGC
TTGCCTCATCCAGGGCGACATCCCTACCGACGTTGACGTATTGCCCACCGGTTATTTTCAGCAGGTTGAGCAGGGGCCGGATACGTGCAGCAGCATCCTT
CTCGAGTGTCGTCGGAGTTGCATTGAAGCTCAGGCATCTTCTAAGCAACTTGAAGCGGTTTAGAGTCATCACAATGTCTAGTGAAGTTGTAGCCCCACCA
AAAATAAGGTCTTCCGGCTGGGGACCCCAGTAGTTGGCGTACTCCCCTTTTTCATTGACTGCCATGAAGAACATAATCCCGAGGAACGCCATCAGCTCCG
ACAGTGTGAACGGCGTAGACGTTTTCACTTCTTTTAGAGCGGCGTAACGGTTCGTCTCGTGGAGGACTTGGCGCCAAAAATACAGCGGAAGGTACGCGAA
GAAACTGGAGCTCGCAGAGTGATCGAAGAGGTGCTTGTATTCCGGACGCAAGTAGGTCTTCGTAGTCCCATCGGCATGCTCATATAAATATGAAGGTGCC
TCAACGTGCGCTGACGGCTCAAACCGCATGCTCCGAATTGCCTCAACCTCGTCCAGGCTGGTTGGAAGAAGCTCCGATGCATCAAAAGCCTCGTAGAGAT
CATCTGCTGCTACGAGGTCAGACTCGGCATCACCGACTTCAATAGCTTCGGAAGAATCAGGCTCCGTCAACACATGCCAGTCGGGATTCTTGATTCGCGT
GAGGGCAACGTAGTTCTTGATGCCCAGTTGGACAGCACCCACACTGAGATGCTCCACGGCGCTCTGGAATTGGCTGTCCAGCCAACGTACTTGAAACAAT
GAAGCAAATTTGCCTTTCTTGACTTGACGACACACCCTTCCAACGATGTACGCAGTGCCAATAGGTCTGTAGACCTTAGCCTTCATCCACACCGACTTTT
CAGGTGAAAAGGCCACCAGTCTATCGACGTAAACATCTTGCAGCAAGACAGGTGGTGTCCGGGCTGGAGTCACATCACTCGGAGACACGACATTTCGTTG
TGGAACGCGAGTCGGTGTCGTGCTTACGGTAGCTTCGAGTTGACCATCGCCGCGACCCCCACCATTCGCTTGGGCGTCATCGTCGCCAGCCGCACTTCTA
CCTCGGTTATCACGCCCACCACGACATGGTTGGACGTCACTTCCGCCAGCCGCGCGTCCACCTCGGCTACCACGCCCACCACGACGTGCTTGGACGTCAC
TTCCACCGGCCGCGCGCCCACCTCGCCTACCACGCCCACCACCACGTGCTTGAACGTCACGACCGCCAGCCGCGCGTACACCACGACTGTCACAATCACC
ACCACCACGTGCTTGAACGTCACTGTCACCAGCCGCGCGTCCGCCTCCACCGACCGCTCGAGCACCTCCGTTTCCACTCGCAGCACCATCTGCACAACGT
AAGCAGTCTCAACATTAGCAATATTAGCAGCAATATCACCTCACCGTTTCAACTTACCACTCGTGATCACTGTGACGTCTGTAGGTCCGGTATGTGCGGG
TAGCTCCATTGGCAGGACGCCGGTTGCAGCGCTGACGAACTGGAGTACGGCAAATTCGCCAAGGAGAAAGTCGACACCTTCCTGTCCTTTTGGGTCCCCG
CCTGGCCGAACATACCGGTACCGGGAATCTAGGCTTTTGCTGGACGGCGGCTTTGCAGACCAACCCTTCTTGCGTAGCTGCACCCACGCGTCCTTAAACA
CAGCGACGCCACCAAGACTAGTCGCTGTGTCAGCAGCAACGGACCCACCTTGTGACGACCCCGTGAGCCGTTGACGCTTGCGCGCTCCTAGCTTCTGAAC
CTCATTTCGCCTTCTGCCAACCATTTGCTCATTCCGAAAGTGAGGGCGAAATAGAAGGCTGCTGTACGTCGTAACATCGTAAACTTATAAAGGTTTTCAA
GTAATTAAAATATATTGAGTTTTGATTTGATAAGTACCATCATACACCGGGTATAATATTTTACAAGGATTTTTCGCGCCGAATTTTTCGCGCGCGGCCA
GATGCCGACATGCTGATTTACATATATCAATACAAATTGCAAGATAAATGCAGGTCGAAGCTCAGATAATACAAACTACAAGGTAGATACACATCTCGAC
CGAATCATACAAACTACAAGGTATATACATATCTTGGCCGCATGCTGGTTGCCAATCAGTCGTGCAGCGCGTATTGAAGGCTCTGAATGATTGATATGGC
AGCCCCACACGAACCAAATCCTCAAGAGCAATCGGAGGCGGGCTTTGAGGTCGCTCCGACACCAACACTTTCCTCCGCAGAACGGCGGTGCTCGATCAGT
ACTGCCATATCAAAGCGACCATTTCAGCATACTGCTGGCCGTGCTCGCGCGTCCTCCTGATTCGGAGGCGCGTCATCGTTCATAGACGAGGATTCCATAT
AATAAATGACGGGTAAATTACTGGATAGGTACAATGTACCGATTATTATTGCCCAATCAGCGGTGTATAGGCTACCCGCAACCGAAAAGCTCCTATATTG
GCCAATCAGAGGCATTGCTAAAAGGGCGCATTTTGCGCCCTTTTAGGACAGTATTGGCTGCCTCAGATTGCATCCCCTGTGATTTGTTTGCACGTCCTGT
CTATATTAGGAACTAAAAGGGCGCATTTTGCGCCCTTTTAGTTTGGAGTTACTTAACTTTCTATACTATAGTTTATCCCTGCGACTCGCGAAAGGGTTAA
TTACTAAAATATAATCAAAAGAACACAAACTCCATATCCTCCATCATCAAGGTGGAGTTTGTATTCTATGATGATTGTAGTTGACGGGAAATCAAAAGTT
GCCATCGCCAACAAACCATAGCAAGTTTACCTGATGGTCTCACGAGTAACTTCATGAAATGCGTTCTTGACGTTAAATCCATTTACCAATGAGTCGACTG
CGTGAGCCGAGCCTCCCGTTCCTGCACTAACCGAAGAGCGCCGCCTGCTAATTGGAGATTGACATGTGACCAAAAGTTAAGCTTGTATCTCTCGCTCGCA
TAAATTAATGAATGTTGCCGGATGACAAACTGCCTTCGAGCCGCAAATGGCAGTTCGTACGAATTGCGAATTTCGACATTGACAAAATATGTGTACTACG
AGATGTAGATGCGGAGAAGATGCGTGATGCTGCGGAGAGAGTAAGGAAAATTGCCAAGCAGATTCAGTTTTGGCACGAGAGTGGAGAAAACCCTGGCGAC
TTCTGTATGCTGCAATTCTAGGTAGCTATCTTCGTCCATCGCCGCGCCCGCATTTCCGCTATGAAGCAAAAATGCGTAGGTTGAACTACGTTTGTTTTTG
AATGGTGCTTTGAACCAGTTGTGAAGACTGTAATATCGCGCCGATTCTCCTCGTCTGAATTTCGTCACTGTTGACAACTCTCCATCGGCGACATTACTTT
CGTTGAGTTGAGTTGAATTAGAATCAGTCCCATCGGTCTATCAACTTCGGAGTTTGTTTTTTGATAAACAAAAACTTTCAGTTTAGATTTACGATTGGAT
AGCTAACTCTCGAGTTGCAGTATTTTTGTAGTGCATGGGCATTCCGTGAGATTTTTTTGCGTCGGCGATTAGTTGAGATTGACCTCGTCGCTATCAATAT
CTAAATCGACGAGACTGTCATTTCAAGCATCTTAGAGCTCAAATCTTGAGCCAAGTGATTAACTGCAGGTTGCATGTTTCCTGCATTATTAAAGCTGTGG
CCTCACGAACAGCAGATTTTCTTCCGTTAAGCCAGTGCTGAAGATTTTTGTATTTTCCTCTCTCCTTCCAGGGCGTAGTCAACGTTCTACGATCCCGCAG
CCGAACACCTGGACAAATTTGTGAGCCTATAAGAAGCCTCATGATGAGACATATTCCGGTTACTATCATTTAAACACAAATAGAGGACCTCTTAACCCCC
CTCCCTCCGGTTACTATCATCTATAACTGAGATGCTTCAAGAAGCGAAGAGAGCAGGTCGCCACCAATCTACAAACGGAACAGCTTCCGTATTGCTGGGC
ATACAGATACCTCGCCCACGGACTTTCAGCGATTCAGGTTTCACAAAACTGGAAATCGTCTTTCTATCCTGCAGAGCACGAGCGATTTCCGCGTGAAATT
GACTGTCAAACAATACTACGAAAAACCTGATTGCAGTGTTTCCCGGGTAGAAGTACCAACTTGTAAACACACGGCGATGCGGGAGCCACTCCGCACGGAA
CTAAGCCGAGTGTATTGATGGGTTGATAGCTAGATGGAAAGTTGAGAAGTGAGGTCCGGGTCTGATGGTAACCAGCACGTCACGCACGCTCTGCTTCTGG
CCCACAGGCATCCCCAAGGCTGACGAAGAGAGAGATGGAATGTAGTGGACAGAATCCGAAAGGCAACATGCACATCGACATGCTAAGCTCCTGATGTAGG
CCAGGCCAGGCACTGGCAGCCAGACCGGTAGATAATATGGCGCCCCACCGCCTGAGGCTGGCGACTGTCTGATGCATCTGGGTTATCTGTGATCACGTCT
ACGCTGGGGTAGCTCCGTCCGTAGGCATGGTGATACCAAGATGAAATATCTGGCATCTACTACACCGATACTGATAGTGCTTTATCAAGGATAGATGGCC
AGAGAAATAGCCCCTAACGTTAGTACGGAAATGTCCGCTAAACGCTGTTTATTAAAGGTTGGATGGTCCACCTATCTCCGGAGTTCGTCTCCAGAGACCT
ACAACTAGACCTATAAACGGCAATTAGGGGCGGGACAGCACGTATGACAACAGCGTAGGAAATATGATAATCAATTTTTCGCTGATGCTAAATGAGAGAT
GATCAAGCCTATTCTTTAGCTCCTGAGTCAGGCGCATTAACCTATTCAATGAGCGTCTCCCCACGAAGATAGCAATGATTGAGACGTTCTCGAAGAGCAA
CGGTAATGTTGCTGGAGGCGGCGAAGGAGGTCCCGCCTACAGAGCATGCACTTTGTTGGAAGGGGGTTACTTTTTCAAGAACATGTTGAATCTGGATCCG
GCGACAGGACGCGAGAATTCGTACCCAATTAAATTGTTCTCTTTTAAAAGCCTGAATAGTTTACCGATGGTTTCGTACCTGATAGCTCACTCAATGAAAA
CGAATTTTCAATATCAAGGTTGTGGCCTTGAAGATAGTTGAGCGCGGATATACGAACTCTGATATCATTTCGTCGAAGCACGCGCATGTTGACTCCTACA
GGCCTTCAGTTTCTCTTACTGGTTTAGAGCAGAATGTTCCGGGGAGGCTTGTCAGGTTTGATATTCTTCAAGCGCAATGAAAGGTTGACAAGAGCTCCCG
CCATTTGAAAAAGTATCAATCTGAATCTACGTCACAATTTGTCAAAGTGGTTTACTCGTCTCGCGAACGTACGATGCGGCCAAAAGTTTACAGATTTCCG
GCCAAAAGTTTACAGATTTTCGAGTTCGATTTTCTAGGTTGTTGTATCACCTTATGCTGAAGAAATGACAAATGTAGTTGCGGGAGGGCGATGACAATTG
AAGAACAGTATTGAAATGAAGTTCCGTAGGATATTTAGGGAGTATGATAGCTGAATAGACCTCAGCAGATAAGGTAAGAAATTACCTCCCACACGTCGAA
ATCGCTTGAATAGACGCAACTTGTCTAGTGGTAATCATAATCTAAGATGTGGCCGGCAGCATCAAAGCTGCAGTTGCCTCTGGTTAAACTAAGGGCCCCA
CTCTCCGACCCAACTGGCACGCACGTGTTCTCAACGTGAAGTTCACATACAGTACGGAATTATTTTGCGCCACGCAATCACCGTGGGGAAATGACGACCG
TCCTTTGATGAAATCAGGACTCCCGATTATGGCATGGTCTTTTACATAATTTCTTATGAAATCATAAATATATTTATTTTCTGGCAGACTTGAAGACCAT
AACATTATTTATTGTGGAGGCACCGATGCATAATTTATAAAGCTCGGCCTTCATTCTAATGAAGTCGTTCAAGCCGTCAAATCATGGTGTCATTAGAACT
TCTAAGCAAAGTAGGTTTTTATTCTCGCACAGACCTCTCCAAAGTAAGAATTTCATGTTTTTGAGGGTGCAATGCACACTCCACTAACGTGCCATTATTT
GCTGTTCGCAGCAGCAAGATGACATAACTTATGTCTCGACTCTCATAAATAAAAATTCCATCATCGGGAGCCCTGATTGAAAGCTTCAGCAAAACGCGAT
CGCAGGGTCCCACAAGTTTTGTCGAGCTGCAGCCAGATCCAATACAGTAGCCCCCACGAACTGAATGACATGCGTGGCTTGAACACATTGACGGTCACAA
ATGCATTGCGCCAAAACTTGAAATTCCCAATCGATGTTGGACGGAATTTGAGGGACGATGAGGGATTTGTGTTATTTAACCTCGGTGAGTTGTGATAACA
TAATAGACGACACGACTGTGAACGACGAGCACGATGGGGACGGCGGAGCTCGTTCATATAACTGAGTCGACTCGCACGTCGTACTCGGGCTGCTCGATTA
GACGTGCTCAACGCGATGGCATCTTAAATCGCGTCGAATTCCGCGCAGGCGCCCTTAATGCATACACGCCAAAGCAGCAACCTATTTACCATATACCACG
TAGAGCTACACGTACAGTAGTAGCAAAATCCCACGCCGTATTCGGGCAGTTCGTGGCAGATGCTGGCGAAGACGACGAGGGCGGTCGACAGGTCCCCTGT
AACAGTCTTGCGCCGAGGAAGGTCTTGCTTGGCGTGTCCGACGTGCGGTCCTTGGGTAGGCAGGTGACGAGGTTGGTGGAGGGGTTGTTGCTATTGAAAG
CAAATTGAGAAGTGATTGAGATTGAGCTGTTTGCTTTTACGGATGTCCTTGAGACCACTAGTGTCCTACCCTAAAGCCTATCCTTCTCTAATCTCAGCTG
CTATCTGTTCTACCAATGATCTTGTCTAAAATATCCACGTAGTTGTAGTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGATGATTT
AGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTCTTATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGAAAATT
TATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCTGACGGCAACTGCGTCACATGACCTCCCTTCAAGAAGACGCCTATTTTGAAAATGG
CTTCGGTCGCTTCTTGGATTTCCAATAGAGGTCGATGAGCCCAGGAATCTGCTTTAGATTCTCAATGGGTTCCCAGGTTGCATCAGCTCTGAATTCACCT
AGCCACCAAATCTTGTACTGCGGTTTTCCCTTGTACATGCGGTGATCAATCACCGCTTCAACGAGTTGTCCTTCGGTTCCATCGGCTAACACGACTTTGT
TCACCTGCTGCCTTCGCTTTGGGTCCTTGCGATACGGTTTCAGCAATGATGTGTGGAACACAGGATGCAACTTTAATCCCTTCGATAATCCCAACTCATA
GGAATCTTTTGAGATCTTCTTTATCACTGGAAAAGGTCCAATGTATCGTGGAGCGAGTTTCTTCGACTGGGCATACCCCTTGTGACGGATATCCAAATTC
TTTCCGTCTAAAAGCACCATGTCGTTGACTTCGAAGTTCTGGACAAGTCTATTCTTGTCGTAATAATACTTCATACGCTCCTGCGCCTCGCTCATACGGT
CTTGTGCGACCTTGAGTAGAGTCTCTTGCTGAAGTAAAAACTCTTGCGCTGTTTTCTCCAATTTCTTAAACTCCGGATCTGATGCCACATCGTCTGGCAT
GTAGGGGACATATCCTAGATCCGCTTCGAACGGCGACATTCGAATCGTGGAGTGTACACGTCGGTTGTAGGCAATTTCTGCCAAATGGAGATATTCATCC
CAGTCATTTTGAGCTGGGTTGACGACACCTCGAAGATAATCTCCGATAAATCGATTTGTCCGTTCCGTTTGTCCATCTGTTTGGGGTCGGAAAGCCGATG
ACAAGTTGTGCTGCGTACCAAGCGCACTCACAATACTCTGCCAAAGTTTGGACGTAAACTTGGTGTCTCGATCGGATATAATGGTTTTGGGTAAACCGTG
ATCCTTTACATAATTCTTCATGAACACGTTAGCGATATCTGTGGTGTTGTCCGTTGTCTTCGTCGCAACGAACTTCGCTCGCTTTGTCAGCCGGTCAACG
ATTACCATAATCGCATCGCAACCTTTGGTGCTGACAGGCAGTGACACTACAAAATCCATTGAGATGTCTGTCCACCTACCCGAAGGTATGTCTAGTGGTT
GAAGTAGTCCCGGCGGCTTGGTTTGTCTCGCCTTGTTGCGCTGACACATTTCACATGTGTTGACATAGCGCTGGATGTACTTCATCATCTTCGGCCAGTA
GTATTTCTCGCGTACTGCCAAATAGGTCTTATAAAACCCTGGGTGTCCTGCTGCTACTGCATCGTGATTCTCGCAAATGACTCGATTCTTCAGATCTTCG
TCATCAGGGATGTACAATCGTGGAGTCTGGTCTTCCGCAGTTTGATAGAAAAGAATGTCATCCTGTAAGGAGTATTTAGGCAATTCATCCCCTTGCTTCA
GCTTCTTGATGATCCACTGTAGATCCTTGTTCCACGAATACATCGACTTCGCCGTTTGGGCCACTGTCACCTTGTTTGGTACAATCGTTGCCACAATTTC
ACGATTCTTGGCTGCTTCCAGTAGCTCTTGTAAGCTTACTTGAGCAGCTTTCAGTTCAAACTCTGGATTTCGTGACAATGCATCAGCCACGGTATTCGTT
TCTCCGGGAATCCACTTGAACAAAGGCTGGAATTCAGCAAGCTCATTGAACCATCGTGCAACGCGTCGGTTTGTAGTCTTCTGAGTCAGAATCATCTCAA
TACTTTTGTGATCCGTTTCGACCGTAAACGGTCGGTCAAGAAGATACACACGCCATACTCGAAGAGCATGCATGATCGCGAGCAACTCCTGTTCTCGAAC
AGGGTAGTTTAGTTCTGCTGGCTTCATCTTCCGGCCAGTATACGCGATTGGATGCTCTAGCCCTCCCTCCTTTTGAAACAAGACTCCCCCGATTGCAAAA
TTCGAGGCGTCCATGCGAATACCAAAAGGTTTTGTGAAGTCAGGAAGGCCGAGAACTGGTGGTGAGGCTAACCGGCGTTTAAGCTCTTTGAAGCACTTGA
GTTGATCGTCCGAGAGTTCAATAGTCTCTCGTGGACGCTTTCCCTTGATGCTGTCATGAAGTGGTCCTGCAAATTGTGCAAAGTCCTTACAGATGTAACA
TTCACAACATGGATCAAGTACACTGTACATTAAAAAATGTTTGTACGACCGGATGCCTGAAGACCTTCCATTCACTAGCCAACTTTGAATCTGCTCAGGC
TGTAACTTGGTTGCAATCTTTTCGGTCGTGGGGGCCCAATCAGCATCTGGGACAGAGCTTCGTCGCCCTAGTTTTAAACCGTCAAGGTCGGGATCACCGA
AACACTTTCCGTATCCTTCACATTGAATTCGTCCATGTACTTGACTTACCTCATGAACTCCGGGTTATCCAACAGCTTGTCCTCCGCATTGGTTAGCTTC
AACCTCGCAAACGCACTTTTCGGAGGTCTTCCCTTCTTGACTTCTTGACCCAACGTCTTCTCAGTGACTGGCGCTGATGAACAAGGTTTCAGTTTCTCCA
AATTTGAGACAGAAATACCTGTCCTCTGTAGTCTATGGCTGGCCATTTCGACACCTTATCCATATACTTCAAGTACCAAGCTTCAATATATTCATATTAT
AATAGGGTAGGTTCATGAGAGAGAAAGCGCACAGGCTTTACAAGCAACGTACTACGGTCTTTCGCAACTGCGTGGACGAGTTAGATCGTGATCCCTCTCA
GATGGTACGCGTTGTAGTCCTCCACGTACTTCTTCCAACGTTTCCAGTTCGCATCCGTCTTTTCTTTCACGTGGAACAGTGTGGCAACAGCGGCCGGGTC
CTTTTCTGCGAAGATGAACTACGTGAGCACCTCAGTCTCCAACTTGTTTGCCAGATCCTTCGTTTTCGGGTTCTTTTGTGCCGCTGTAATGGCCTTTACC
AAATCTTCGTCCTTGTAGATAGTCGCCAATACGGTCCGAGGAACAATCTGACCAGGGAAAGACTTGTGGAAATCATCCATGAACTTCATCCAATATGCGA
ACATCGGGCTTTCGAACAGCTTTGAGGGCTTTATCCGATCTAGTTTGAGTAACTTGAAGGCGTCACCCGGTGACTGCGACCTCCAACGTGGTGGCCACTC
CCCTCGTCCCCGCGACCTTCTTCGCAGCGTCGAGAATCTTCGCGACCGCTTCGTCACCGTAGTAAGTCGTAAGTTTAGCGATCGCTGACGTTGTCTTGCC
AGGATTCTTGGCGGTAAAATCGTCCACGTACGTAAGCCACGTCGTGAACGGCGGGTTGTCTAGTAGTTTATCTCCAGCCCTCGTAAGTTTCAGGCGAATA
AAGACGTTGTCGATGGACTTCCCGTTTTTCAGCCAGGTCTGGAGTTTCTTCGTGGTGGCAGTCGAAACCAACGCTTTGGCCTTTTCAATAACGAAGCTTG
GGAGGTTCACTCTCTCTTCACCGTCGTCGTCTCCGTGAGCGATGAAACCCAACGGTAGCGAGCTGATCGTGATTCGCGATGTGTAAACGGGCCTGAGTCA
GGGAGTCCGGTTGAATAATCTCCGATTTCTTGTGTGCGGTGGCCGTATCGGTACTGGCCAGGAGTGCGACAGCTAGCAGCCCAACGCAGCTCAGACGCAT
CGTTCTCTTTGAGAGTACCGGTACTCGGGAGAATGTTGAGTAGTAATTAGGAGAGCTGTTCACGGACAACTAATTTGTGGAGCAAGAGCCTCATGCCAAG
AGGATGACCACGTAATACTCCAGTACGGGTGTTTACCACACAGCCTACATAACAGAGGGATTTCCGATGTTTTTTACCCAGCCGATCCGAAATGTGTATC
TCTGAGGAGAGACTGTCGTCACGACAGTGTGGTCACCAGTCTCTATTGGCATATCTTCAGGTAATGATGTACATGTAGGTATTGTATCGTACCAAGGAGT
ACATGCACTCATGCAAAGTGCACAGTACATCTTGCTGCAGTTTTGGGTTTGCACTCGGTAAATTGCAACGCAGTTGTATAAATTCGACTCGGACTGCGTT
GTACTTACGTTATTTGAGAAACAGAACTTTGGAGCAACTCGCAAACGTCTTACCTGAATTTATCAGGAGTTTGCACCAATGGCCAGGATGGCGCAAGAAA
CATCACCTTACGCAGTCGTTGTTGCCCAGTAACTTGTTGTTGATACCCTCGAGTCGGCACCAACCTATCGGCGTGGGACTATAGTCATTGGTTTGCCTCC
ATTGGCGTTAGGTCCGGCCAGGCCCATATCCTCGAGGAACTTGTCCATCCGTGCGGACTCCTTCGCCTAGAATTAATTGCAACACACAATAAGAAAAGAC
TGAGCAACTCACACCACCAAACCCGTCATTTGGAAACGCTGTACCTTCAGACCCGCGAGCTTCTCTTCCTGCATCTCCTGTTTGCGGCGTCTCGTCGAGT
CACGCTGAGCCATCCGGCGCTTGAACTCCTCGTCGCCATCTCCTCGACCTCCGCCCATCAGAAAGTCTTCGCTCACATCGAGGCCATCCCGTGCATCATC
CCGATCTCTTGCCGCACCATGGAGCTTTTGGCTCAGTTGTCGTCGCTTCTCAATCTGAGCCTCTCGTCCTGTAGCTTTGGGTGCCAGTTCGTCCATGACC
GTATCGCGATATTCTCGTTCTCTTTTCTGGTCCAGCTTGCGACGTCTCCACTGCTCCTCCTTGTCTTCTTCGAGTTCCTTGGCTCTGCGTTTGCTCTTGC
TGCTGTCCCTGTTCTCCTCCAACTGTGGGCCCTTCACACTCTCCCGCTTACCCCCCGAACTCAGCAGATTTTCTCTCTCTTTGTGGCCACATCCACCGAG
TCTTTAGCCGTCGCCAGCTCGAATTTCTCCTTTTCTCCCAGTTTGGCGACGAACCCCCAGCGATGACGCGTCCGCTTGGTCTGCTCCACCACCGCGTCCG
GCAAACCTTCGTAAAACATGGTGGACAACTTGCCCCGGTTCCATTTCTTGGCAAACTGGTCCGTAAACAACTCGGTCGCCTCGTCCGTCGACAAATCATC
GACATATTTGCCCCTGATAGAAACAGGAGATCATAACATATCAAGAAGAAAATAAGACCAGATAGTCTCTTTATCTAAAAGAAATAGCAACGCACTTTGT
CTGTGCGAGCCACACTCGGAACTCCGTCTGTCGCAGAAAATAGTCCTCTTCCGAGATTTTGTTTGTGCCTTTGGGCAGTTTTGTGTCTTCATGGCGACTG
GTTTTGTGACTTTTGTGGCGCTCATCCTCGGACCGGCGGCTGGCCTTGCGACTGGAGGAGGACGAGAGCTTCTTCGAGTGCGTGTGCGGCTTGCGGCCCC
TGTCGCCTGTAAAGAAGACGAAGACGTTAGAAGAGCCCTGCAGGAGAGGAGAAGAGAGCGAACGCACGATGATCTCGCCCCATTTTGATACATGCAGGTA
AAAAAAATTTGTTTTTGGCCAATCGCATGTTGTATATCCTACAAACGTATCTAGAAAAGCAGTTACTGTACGTTGTGATCGTTGACGACATCGCGTTTCG
ATGTCGTGGGCTGCAAACAGCGAACCAGAGCATCGGAGCGATCGTGGTGGATACTGCATCACCTGTTTGGAGAACCACACACTACAAAACGCGGTTGCAG
CAGTACTCGATTCCCACCGATTGGCAAATATACGAAAGAGGTGCTCCGCCACGACAGCGTACCTGTCAGGTGGGTGAGTTCAAAGGAAAACCCGGCAGAA
CTTTCCAAAATGCTCAGTGGTGTGGATACCGCTGATGAAATGATCCAGCGATACATCAAGATAGCCAACTTAGTGTAGGGAAGCATCACGCAAGTCCGCT
TTGGATGATGATGCAGCTAATATTTGGTCATGATGATACCGGTAAGTGGCCTTCTATTTGATGTGTATGTTTCCTATCAATGTAGTAATAACATAATTGA
TCTCGCTCGTCTGTCTTGGAGGGGTTGTATCCAGTTGATCTTGTAGCGTGAAGGTGGAAAGGTATTCCTGCATCGGGTCCGGGGTTGCGTTGGGTTGTTG
TAGGTGGAAGTGTCGAGTCTTGTGTGTGTGTTTGCCAGTGTTTAAACTGCTTCCAGGTCCGCTTTTGCTGGTGTGCTCCATTACACGACGAAGAATCGCT
GTAGCACATGACTTAGTTCCTGGGCGGGGCTGTCGCTCACGGTTGTCTCTGGTTTTGCACTGAGGGCTCCTTGATTGTTTTATCCACACTGATGCAGGTA
ATATTTCGACGCTAACCTCAATAGTTTTGTAGTGTCACTGCAATGGACATGGGAACTGCTCTTTGCTTTGACAGGTTGACAGGCAGTAGCGTACTCCGCA
GGTTGTGCACTTTTTATTAATAACTCATTGTGGTGGTAGCAAACGCTTGCCAAGGGTCTTGCGAGCGCAGGCACAGCGTGAAAGTGAGCTCCGTTGTCTA
TGCTTATGATCCTGCTTCCCTGGCCTTTGCATTACTACATGTACTGTTGTACTGTACAGACGTTCCTCTAGGTCGTGTAGATTGTAATGTAAGCAGCTGG
AATATCATCCATCGAAGGTGCTTAATTAACTATGGAAATTATCCGTTCGTCCAATGACGCCCCCAAAACGCACCATCGGCCTCTGCTGCTTGCGGCCAAT
GGTCTCAGGGGAAAGCCAGTTCTTGAAGTCTTGTCTCTAGTCACTTGTCCGTCATCATGATGACGGTGCTCACTCATGAATGTGTTACCTGTATTTCAGG
ATATGGGCTCAAATTTAATAAAGAAAACATAACATAAAACTCGTTGAGACAGAGCATATTATCCGGTTCTACTCGAAATTTCCGCGCGTGGCTGATTCAA
TCGACCCTGACAAAGTGCTTGACATACTGGTGGACACGGTGCCGCTGCGCGGGACCTCTACATGTGCCTGCCGGTTATACACAAAGCGCCCGTCATAAAA
TCCCTTCATCTTACTATGCAGTAGGCATACCCAAGTACGGGCTCGACTTGGTAGAAAGCCACACAGTTTGATATCGGTCGATTCCCAAATGGCTTGGAAA
CTATCGTCCTGAATCGGAAGGGTCTCTCGATTCGCTGCATAAGCTGGTCCTTTCATCACCGCTGTGCTACAGTGCTACGTTATGCGCACCTCGGTGTTCC
GATACCGCGTCATATCTGTTTATCGCTGCTGGTGGGGTTATCGCCCACTATTGTGGCCGACTGCCCGTAGCGCTGCCGGCGAGGACCGGGGGGACGCAAG
TCTGGATCGGAAGATAAGCTGGGCGTTATGTTAGCACAAGGATGGCGACTAGGACGGACATAGGAAGTCGTTAGCGTAGCTAAATGATACCCATGTACCT
TCACTGAAAAACGAACACTAAAACTTATTGCCCACTACAAAATAATGCTATAACAATACTCAGCAAACCAGTAAGAAGGCTAGGACAAGGTGAATAACAT
GTGCAAAGCTGCTATTTCTTATTTCCCCAGACATTTTCGTTTTTCAGTGGCGTACATTGATGTCACTTAGCTGCGCTAACGACTCCCTATGGCCGCCCTA
GCTACCGTCCTTATGCCAATAAGTACCCCATGCATTGCATTAGGTAGTTACACTCCGATCTGCATGTACCATGATCACTCGAACACTACCAATACGATTG
TCAACACACACACACACGATCTCCGCTCTGCTTGTGGTCGATCCTGCAATTGCTACTGCAAATGCTGTTATACGTTTTAAGAGGTTACCCTGTCCACGAA
GCCGTGTAGCAATGCACTGGTCCGGATGGTATGGTATGCTGGGAAACAGATGCTCAACCTTTCTGGGAAGAATTTACAGCTGCTCCTTGACCTTTCCAGC
TCGAATGGTAATTTCATTCACAAACTTGCCCTCTAGCGCTCCAGTCGGAGGATGCACCGCTGTTTGCTTATTACGTTGACTATATCGTCCGTGCTTCTAA
GCCTCGATGCCAGTGCAGCGGCGCAACATTCTGAACCAAGCCTCGCCATTGTTTCCAGCTCGCATCGTCTCGTAGTTCCAGACAAGATCGATATTGTCCC
CGCGGTGAGATTCTTGAGAGCTGGCCATACGGCGCCTGATGAAGGCGAAGAGAGAGCGGGGCTCTCCGTGTCCATGGCCGAGAAGGCTAAAACGTTTCTC
TCCTCGTCGACAATCTCCACCGAAAAGCTCCAGAAATGGCTCAGCAGCGGCAAAAATGCAGACACTGTTTTCTCGCGCATGCAGCTTACCAAGGCTGGGG
ATGACCTGCTTTCTAACCCACAGTTCTCCGTGTGGATCAAGTACGTGGATGATTTGAGCGCCAAGTACCCAGCCAAAGCGACGTCGGCGATCTCGACGCT
GACGACTCAATACGGCGATGATGCACTGTATAAATTGCTTGAAGCTGCCAAAGAGGTCCCAAGACAAGAAAATCTCGCCACCAGGCTGCAAGCCGAGCAG
ATGCAGCACTGGGCTACCGTCGGAAAGTCCCCTGACGACGTCTTTCGTCTGTTCGATCTCCAAAAGGCAGGAAATTCCATTCTCACAAACCCGAAGTTTA
CCTCATGGACCACATATGTGGACAACGTTAACGCACTGAACCCGGAGAAGGCAGCATCAACGATCCCAACGTTGACAACTTACTACGATGATGATATACT
GTTCAAGATGCTTGATGCCGCCAAGAAGTCGGACGAAACAAAGAGCATCGCCACCAAGTTGGAGGCCCAGCAGCTTCAGGGATGGCTGAAGAGTGGGAAA
TCGCCGGATAATGCGTTCGCTCAGATGGGACTTAGCAACGTGGAGGATAATCTGCTGGCGAGTCCGCTTTTCAGCACTTGGGTTAAGTACCTGGATGATT
TCAATGCGCAGTACTCAGCGAAGGAAACAACTCTGTTTCATGTTTTGACGAAGAGGTTCGAGGATGAACCTTTGGCAAAGATTATTGCTTTCGGAAAGAC
ACTGGACAGTACGAAGGCAGTCGCAGCAAAGTTGGAGACCCCAACAGAGGCAAGTCTGGCTGACTAGTGGTAAATCATCGGACGACGTCTTCACGCTGCT
GAAACTTGACAAAGCACCAGACAATTTCTTCGACAATCCGCTGTATAAGACGTGGGGCTCGTACATGAACCTCTTCAACAACAAACATCCGGGGAAGCAA
ACGAACTTGTTCAAGACGTTAACGACCAAGTGCAAAGACAAACCATTGATCAAAATCCTCGAGGAGGCGAAGAAGTTTCCGAATCTCGAAAGCACTGCCA
GC