Description :
From Genome Similarity Track
Location :
contig_50:137622- 160809
Transcript NameFunction/comments
g9907.t1hypothetical protein
g9908.t1hypothetical protein

Sequence
23187 bases(100 bases per row)
ACTATTTCCATGACCCTCGTTAGCATACTGGCCTTTTCCAGGAAAACTGTTGAGTCATCTACAAACGCCGAGAACGTGTGCTCGGCTGCCGGTGTTCCTG
GAACTCGGAGGCCTTTGATTTGCCTGTCCTGTTGGATTGCTAACGCTAATATTTCTGCCGCGAGTAGAAACAGAAGTGGTGCGAGTGGACACCCTTGCCT
GATACCGGATACGATGTCGAGTGGCTCGGACAGGCTGCCGTTAATCAAAAATCGTGCTGTCGTTCCTTGATGTAACTTCCTGATCATTACTCCGAAGGCG
TTCGAGAATCCGAACTTTTCCAGTACTAGGAAGAGGAATTCTCTGGCCACTGTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCA
GTGCTGCTAGGTCGGGTTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATCATCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGA
CTCTCCAATTGTACGTCCCATCACCTTTTGAACCCGGGATGCTATGATCTTCGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCC
ATCGCGTTGTCCGAGTCTCCTTTCTTCCGCAAGGGAATGATGAGTCCTTCGAGGAAAGATTTTGGTGGTTCTCCTCCTTTTAGGAGTTCATTGCCGATAG
CCACCATAGCTGGCACGAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTGTTGAGGCCATCCGGGCCCGCTGCTTTATGCCTGTTCAACGCGTCAAATGC
TTCAATGACTTCATCCGTCGTGATCGGCCTCATGAGGAGCTGGTTTCCTTGCTCAGTGACCTTTCGCTCTGCCGGTATAGTGACAAACGCATCAAATTCT
GCCTCCATCGCTTCCGACTTGATTTCATTGTGCTCCTTTCCTAATATGGGTTTCCATTCCGATCCGAATCGGTCAGCGATTGTATCTCTCGTGTGAACTC
CTTTCCATTGAGTCTACTGATCGTTGAGATGGTCTGATCTCGCTCCCAGTTTGAGACTCGTTTGTAGTTCCAGCGAATTTGTTCCATTGAGCGCTCTAAC
CGCTGCGCTGTTCGCACCAGGTGCTCCTCCCCTCCGTGACCGCGATGAGTTGTGATCTGGTCATTGGCTGTCCTCTATTTTGAGCGGCTATCTTGTGCAC
TAGTGTGTTGCGCCGTTGATTGTCTCTGCGCTTCACGTGTTTGATGCATTGTACGCAGGTTCTTGCTTGATCATCCCAGTTGGCCACCGTGGTGTTCCTT
CCGACTCCCGCCTCCGTTAATTCAGTGAGCAGCTCCTGTTGGACTCGTTCTGGTTGGGCCGTCCTGATCGGGTAGGTTACCTTTTGCCCTTGCCTCCTCC
GTTTGCTGCCTACCGGTGCTGCGCTCCAGTGCAAGCTGACTCGTTGATGGTCGGTTGGCAGCGCTGGTTCCTCGACTGATACCCATTGCACGTCGCTGAC
CCAAGATTGAGGGACGTAGAAGCGGTCTATTCGGCTGGCCGCTTCTGGGCCCCAGAAGGTGTAGAATTCGGTTGGCTCCGGGTCTTCATCCGTGCCTTCC
ACTGGATCCACCATTATTCGGGCATCCTCTAGGTGTCTACCTGTCACGAAGTCCCGTAGCGCCGCTGATTCCGGTCTCCCCGACCTCTGGCCCCCTAGTC
GATCTAGTGTTGGACTCTGGACGCTGTTGAAGTCCCCTGCAAGTACTACGTCGTTATCCGGCCAAGCCCAGTCATTCAGGCTTCTGAAGAATTCCTCGCG
GTCTGCGTTCCCATTTGGCGCGTATACGTTTACCACGAGGGCTTCGTCAATGCGCACCGCGATCACCCGACTTGACCAGTGTTGCTGGAGCGCTGGCCGC
GCGGTTTTCGCCGTGGCTGGTGTTAGCAATACCGCTACTCCTCCTGATCTGCTGTCATTTGTGCTCCAATACGACATCCTGGGGCAGTCTCTCGAGTTTT
GTTGCCCCCATAGTCTCCTCCAGTCCTCCTCCAGTTTGGCCGCTTCGTCCAGTGATCCCACATGCGTCTCTTGTACTAGCCACGCCAGTGGTCTCTCCCT
TACTGGGGTCCTCCTCCACGCCGCCATCCACCTTCTTCTACTTTCCTCTTTGAAACCCCGCTGTCTAGTCGTCGCTGCCCGACTTCTGGCTGCCATTGTC
TCCTCTGCGGTTCCGTCCTCCGCATTCCCCTTAAAAATCGTAAACGTCCGTAAACGTCTACTGCCTCGCCCCCTACTATGCCATCCGGAGGCGAGACATT
GGCCTGCTCCGCGCAGCCCTTAGTACTGGTGATTTTGAGCTTCCTCTCCTCGTTCTATAGTCGAAGAGAAGAATCGCGCCACTGCAACCAATCTAGGGAG
TGTTTAGTCGTTGCATAAGCCGCCTTGTAGCCTTCATGGGTTCGTAGCGCTTCGAGGTGTCTCGTCAATCTCGCGAGCGCCCCATTATCGTCCTCGTCCT
CCGAGCCCGTTAGGATTCTGATTTCCTGGTCATAGATCACGGCACATAGGAGGTGCTGCGCGAGGCGTAGTTTGTTGCCGATGTCGCATAGTTTGAGAAC
TTCATCGTTACCGTATCCACACGCCCGCATCCTGACCCAGTCGTCTCGGTTGTCTATCAGCGGCGGTAGCCGAGATTCCCGCGATGGGAATTTACTTCTC
CACGCATCGATCCACCGATGCACCTCCGGGTCGTTCGTACGGTCTCTTAAGCGCCTAATTGTGCATATAGACACCCCCGTCGCCATCCTGCTGTCCATTC
CTCTAGAACTTTCTCGCTGAGGGAGGTTAGGAGCTCCTCTGGATATGGAAAGCGCTGCACCATGTAGAGCAGCTTGGACGGCTCCTTTTGTGCGGCTTGG
ATCCATTCCTGCGTCGGGCTTCGATCGAGTGGTAGTGACACTTGCGCTGTTTCCGGCCATTGTTGGCCTAACTTCTGCCATAAATCTGGCCATGCATCTC
GGGTCATAAGCGTCTCCGTTGCTGGCTGCTCGGCGATGTCCTGCATAGAGACTGCGCTGGCAGTGTGCCGCTTCGTTTCCTCCTGGGTCCGCATGATTTG
CCGAATTTGTTCTCCTTCAATCGGAGTGGTTGAGTGATTACGCTTCTGCGTCCTGGCCTCCTTGGTTGCCCTTGTCGCGGGGACTGCGACCTGCTCGGCA
CAATCGAGCTTTGGAGGCAGTGTCGCCGGATTACGGCCTTCGTTCAAGCTACGATGGCGCCGGAGCATAATCGAACAGTGCTTGGTTGATGACAGAGTTG
GTAAGGCGCATGCCACGGGCCTATCAAGGTCGCGTGGTGACGGCAGAGACGATGAGGCGTGTCGTGTACGGTACTATTGGCCTCAATGCACGTGACACGA
TGCGTCAGTGGGCGGAGGCACGCGCTCAACTGCATGAAGGCGAGCAGGCCGCAGGTAGGCGAGCAGCTCGCAGATTTTACATGATAGCTTTTCCCATTAA
TAAACTTTCCTCTTTGGAAAACAACCCCGGGTATTCGCGACAATGAACCACTGCTCATGACAAGCTAAAAGGCAGGTATTGTCTTCAATATAAACGCTAA
ATCGCTATTGTTTTAACCCTTTCGCGGTACAAGGGTGCATTTTTCGCCCTTTAAGGCTATTGACAAAATACGGTGAGAATGTGCCTCCTTAAAGGGCGCA
TTTTGCGCCCTTTAAGGTCCCTCTTCGAATTCGGCTATCGTGTATTGTTACTACCAATCAGAGCGCTTGGTACAAAAATAATACGGGTAAATTTGGGCAT
TAGCGGTTATATTTCCAGTTGTGTCTGGTAAGTACGAAGTATATTGTGCCACGTCGCCGTCACTTGAACATAAAAACGATAAAATGGACGTCTTCGTGCA
ACGTCGCCATGAACATGTCGCCAAATAGTGGACATAAAATGAAATCAGTGCATATCGCCCCCCCCTTCCGCCCATCTTCCCTCCCTCCCTCTTCCAGTCG
ATTTCTACTATACTAAAAACAAGTTTCATACACCCTTCTTCTATCTTTGGCCATGCGCACGCTATTCGAGGACTGGGAGGATAAAGCCCTCGTCCAGATT
GCATTTCAGTTTGAGCGCGAAGGAATCCGGATCACATGGACTACGTGGCACGCCGGTTCAAGAAGAAGCGGACTGCGCAACAGCTACGCTTGAGGCTAGC
TAGCCTCAAGCGCACGTATGGGAGGAGAATCGTAGACTTCCCACCGTGCTTCTTTTCCAGTGTCGCTCGGGGACGACTTTTGCGAGCAGTACCAGAAGTT
CGACCTCAACTACCAGTCTGTCGAACACGAGCAGCAGGGTCATCGCCCGCTTATCCGATGACTGCGAGTCCAGATCAAGCAGCGATTTCCCGTTCTTCAT
ATCTGCACTCCATGCTGACGCCGACTGAAGCGTCTCAGGTAATGGCTTCCCTTTTTGGGAGCATCAGCGCCGGAGATATACGGCAGCCAGCAGGTCGTGT
GCACGACAATGCTGGAGAGATCCTCCCTCCAGGTGTCTCCACCATCGTTGGCGCTGTAGGTCCCGTTGGTGTCCGTGACGTCTTCCTCGATGTTGGGTCA
GGAATAGGCAATGTTGTCGCCCAAGTCGCGCTCATGACAAGTGCCCGCGTCTGTGTTGGAGTTGAGCTTCGTGCCGAGTTGTGCTCACTTGGTCAAGCGT
GTATTGAGCGCTATGCAGCCTCTCTACCTCAGCTTCGCAAGGTGTATTTGAAGGCCTCAGACGTGAGAGATGCTGCTCTGTCATCACAGGCTCCCACGTG
CGAAGCAACCATCATCTTTGCGAATATCTTCCTCTCTGAGGAAGATGCTAAGTTAGTCGTCGCGCGTGAGCTCGCTGTGATGCCAAATGCACGAGTAATA
GCAGCAACTTCTCGCTTTTGCCCCAGACACCGTGCTTCCTGCTCGGAGATCTTTTGCACTCACTGGTCGTTAGTGCGTGAAGTAATGGCGTCATGTAGTT
GGAAGTCGTCTCTTCACCCAATTTATATTTACAATAAAGCCTAAGTTTCAAACTACATACACTTTCTTTAGACAGCGTGGTCGGCAAGGCTCCTAAGTCG
ATCTTCATCAGCAGGTCCGCGCCAACGCCGACGCAATCTTCACGAACAGGGCGGCACTGACGCCGTCACGAACTTCATCAGCAGGTCAGCAGGACGGCGC
TTCCCCGACATCAATTCCAGGAGCTGCACGGCGCCGAAGCCGGCGCGATCTTCATGAGCAGAACAACGCTGATGCCGCCGCCATCTTCACGAGCACGATG
GTGTCGACCCTTCCGTCAAGTTCAGCAGCTGCACGGCACAGACGCCGCCTCGATCTTCATCAGCAGAAGGCGACCACACCGACGCCAAGTCCACGAGCTG
TGCGGTGACCACGCCAACGTCAAGTACACGAGCAATTACACTTACAGATGGATTTGACGAGTTGCACCTGGCTTCGCTGTTGGTGAGGTCTCAATTTGGG
AGGCATCTTGTCGAAGTTTGGTAAGCTGAGAGTGTCGCCGGATATTGCCCTTGTCTGTAAACAAGCTTTGAGGCTCGTAGAACTGGTGAAATTTTTCCCA
GCACGTCAATTCAATCTGCGGGCACATCCACGGCTTCGCGGCTTGAACGTGCACCACTCGACATAGGCACACACTGTGTGTCACGCAGTAGTTAGTTACC
TCGGTCGGGTACCGGCCCTCCCATCGACAAACAATGCAGCTTCGGCGTTTCCTGTTCCTCTCCGCGTATATTTGTTTGGAGGCCACGGAGGCGCACCCAC
TCACTGCCAGCCTATTGCCTGACTCAGTTTGCATGACTGGGCATGCGTGGGCTGATGCATCTTCCTCTTCTTCAGCATTACGACTTGTGTACAGCATACG
ACCTTCGCTAGGCGCTTCAGCCCACTGACCGTTGATGAGCTCGGCCACCAATTCAGTGACGAACGCTCGATGGGGATCTCGTGCAGTAGAATCGGGCTTT
GCCAGCCGTCGTGTCAAGTAAGCATTCGATCTTGCAACATCTATGAGCGCTAAGGCAAGTTTCTTATGCCAGCGCTTGTAGGAGTGCCCGTCCGCAATAG
AGAATCGTCCTCGAATTTGATCGAGTCTATCCACCCCTTGCATATTCCTGTTGTATCGAGCAACGCAAACAGGAGCCGAGAAAGCTCGCCTCTCACTTCC
TATCATACGGTTTACGGTAGTGGTAGTTGACGCGTCAGCATTCGACACCATATTCACCACATTTCCGTCACACCACGAGGCTGCAAGCATGCTATGATCA
GAGGAGACAGCCTGCCGGTGGTCACCGCGCACGCAATCGTCTTTGTGGAGGATAGTGTGGCTGGGGAAGTGTTTGCTGTTTGATCGTATCGTCCCTCTGG
CGTAAAGACCCTTTAGGCGAAGCTCTTGGAGCAGCTGAACACTGGTGTAGTAGTTGTCCATATTAAGAACCCTGTTGGACCCAAAAAATGGTCGTGCCAC
CTCCAGAACGTGTTGTCGAATCTTCGACACTTTCTCTAGCTCCTCACGTAGATCCTGTGCCTCCACTTGGCCTATAACACCATGCAAGCGATCGGAGATG
TCGCTCTGGTTGCAATGAAGTCTGTAGTTCAATGAAATCCAGGTGCTCGAACAGCAGATCATGTATAGTCGGAAATGGTACTTCCCTGTTGGCTTTAAGG
GATTGTACACGATGAGGTGGCGTCCTTGACGAGAGCGACAAGCTACGCTTGCCTCATCCAGGGCGACATCCCTACCGACGTTGACGTATTGCCCACCGGT
TATTTTCAGCAGGTTGAGCAGGGGCCGGATACGTGCAGCAGCATCCTTCTCGAGTGTCGTCGGAGTTGCATTGAAGCTCAGGCATCTTCTAAGCAACTTG
AAGCGGTTTAGAGTCATCACAATGTCTAGTGAAGTTGTAGCCCCACCAAAAATAAGGTCTTCCGGCTGGGGGCCCCAGTAGTTGGCGTACTCCCCTTTTT
CGTTGACCGCCATGAAGAACATAATCCCGAGGAACGCCATCAGCTCCGACAGTGTGAACGGCGTAGACGTTTTCACTTCTTTTAGAGCGGCGTAACGGTT
CGTCTCGTGGAGGACTTGGCGCCAAAAATACAGCGGAAGGTACGCGAAGAAACTGGAGCTCGCAGAGTGATCGAAGAGGTGCTTGTATTCCGGACGCAAG
TAGGTCTTCGTAGTCCCATCGGCATGCTCATATAAATATGAAGGTGCCTCAACGTGCGCTGACGGCTCAAACCGCATGCTCCGAATTGCCTCAACCTCGT
CCAGGCTGGTTGGAAGAAGCTCCGATGCATCAAAAGCCTCGTAGAGATCATCTGCTGCTACGAGGTCAGACTCGGCATCACCGACTTCAATAGCTTCGGA
AGAATCAGGCTCCGTCAACACATGCCAGTCGGGATTCTTGATTCGCGTGAGGGCAACGTAGTTTTTGATGCCCAGTTGGACAGCACCCACACTGAGATGC
TCCACGACGCTCTGGAATTGGCTGTCCAGCCAACGTACTTGAAACAATGAAGCAAATTTGCCTTTCTTGACTTGACGACACACCCTTCCAACGATGTACG
CAGTGCCAATAGGTCTGTAGACCTTAGCCTTCATCCACACCGACTTTTCAGGTGAAAAGGCCACCAGTCTATCGACGTAAACATCTTGCAGCAAGACAGG
TGGTGTCCGGGCTGGAGTCACATCACTTGGAGACACGACATTTGGTTGTGGAACGCGAGTCGGTGTCATGCTTACGGTAGCTTCGAGTTGACCATCGCCG
CGACCCCCACCATTCGCTTGGGCGTCATCGTCGCCAGCCGCACTTCTACCTCGGCTATCACGCCCACCACGACATGGTTGGACGTCACTTCCGCCAGCCG
CGCGTCCACCTCGGCTGCCACGCCCACCACGACGTGCTTGGACGTCACTTCCACCGGTCGCGCGCCCACCTCGCCTACCACGCCCACCACGACGTGCTTG
AACGTCACGACCGCCAGCCGCGCGTACACCACGACTGTCACAATCACCACCTCCACGTGCTTGAACGTCACTGTCACCAGCCGCGCGTCCGCCTCCACCG
ACCGCTCGAGCACCTCCGTTTCCACTCGCAGCACCACCTGCACAACGTAAGCAGTCTCAACATTAGCAATATTAGCAGCAATATCACCTCACCGTTTCAA
CTTACCACTCGTGATCACTGTGACGTCTGTAGGTCCGGTATGTGCGGGTAGCTCCATTGGCAGGACGCCGGTTGCAGCGCTGACGAACTGGAGTACGGCA
AATTCGCCAAGGAGAAAGTCGACACCTTCCTGTCCTTTTGGGTCCCCGCCTGGCCGAACATACCGGTACCGGGAATCTAGGCTTTTGCTGGACGGCGGCT
TTGCAGACCAACCCTTCTTGCGTAGCTGCACCCACGCGTTCTTAAACACAGCGACGCCACCAAGACTAGTCGCTGTGTCAGCAGCAACGGACCCACCTTG
TGACGACCCCGTGAGCCGTTGACGCTTGCGCGCTCCTAGCTTCTGAACCTCATTTCGCCTTCTGCCAACCATTTGCTCATTCCGAAAGTGAGGGCGAAAT
AGAAGGCTGCTGTACGTCGTAACATCGTAAACTTATAAAGGTTTTCAAGTAATTAAAATATATTGAGTTTTGATTTGATAAGTACCATCATACACCGGGT
ATAATATTTTACAAGGATTTTTCGCGCCGAATTTTTCGCGCGCGCCCAGATGCCGACATGCTGATTTACATATATCAATACAAATTGCAAGATAAATGCA
GGTCGAAGCTCAGATAATACAAACTACAAGGTAGATACACATCTCGACCGAATCATACAAACTACAAGGTATATACATATCTTGGCCGCATGCTGGTTGC
CAATCAGTCGTGCAGCGCGTATTGAAGGCTCTGAATGATTGATATGGCAGCCCCACACGAACCAAATCCTCAAGAGCAATCGGAGGCGGGCTTTGAGGTC
GCTCCGACACCAACACTTTCCTCCGCAGAACGGCGGTGCTCGATCAGTACTGCCATATCAAAGCGACCATTTCAGCATACTGCTGGCCGTGCTCGCGCGT
CCTCCTGATTCGGAGGCGCGTCATCGTTCATAGACGACGATTCCATATAATAAATGACGGGTAAATTACTGGATAGGTACAATGTACCAATTATTATTGC
CCAATCAGCGGTGTATAGGCTACCCGCAACCGAAAAGCTCCTATATTGGCCAATCAGAGGCATTGCTAAAAGGGCGCATTTTGCGCCCTTTTAGGACAGT
ATTGGCTGCCTCAGATTGCATCCCCTGTGATTTGTTTGGACGTCCTGTCTATATTAGGAACTAAAAGGGCGCATTTTGCGCCCTTTTAGTTTGGAGTTAC
TTAACTTTCTATACTATAGTTTATCCCTGCGACTCGCGAAAGGGTTAATTACTAAAATATAATCAAAAGAACACAAACTCCATATCCTCCATCATCAAGG
TGGAGTTTGTATTCTATGATGATTGTAGTTGACGGGAAATCAAAAGTTGCCATCGCCAACAAACCATAGCAAGTTTACCTGATGGTCTCACGAGTAACTT
CATGAAATGCGTTCTTGACGTTAAATCCATTTACCAATGAGTCGACTGCGTGAGCCGAGCCTCCCGTTCCTGCACTAACCGAAGAGCGCCGCCTGCTAAT
TGGAGATTGACATGTGACCAAAAGTTAAGCTTGTATCTCTCGCTCGCATAAATTAATGAATGTTGCCGGATGACAAACTGCCTTCGAGCCGCAAATGGCA
GTTCGTACGAATTGCGAATTTCGACATTGACAAAATATGTGTACTACGAGATGTAGATGCGGAGAAGATGCGTGATGCTGCGGAGAGAGTAAGGAAAATT
GCCAAGCAGATTCAGTTTTGGCACGAGAGTGGAGAAAACCCTGGCGACTTCTGTATGCTGCAATTCTAGGTAGCTATCTTCGTCCATCGCCGCGCCCGCA
TTTCCGCTATGAAGCAAAAATGCGTAGGTTGAACTACGTTTGTTTTTGAATGGTGCTTTGAACCAGTTGTGAAGACTGTAATATCGCGCCGATTCTCCTC
GTCTGAATTTCGTCACTGTTGACAACTCTCCATCGGCGACATTACTTTCGTTGAGTTGAGTTGAATTAGAATCAGTCCCATCGGTCTATCAACTTCGGAG
TTTGTTTTTTGATAAACAAAAACTTTCAGTTTAGATTTACGATTGGATAGCTAACTCTCGAGTTGCAGTATTTTTGTAGTGCATGGGCATTCCGTGAGAT
TTTTTTGCGTCGGCGATTAGTTGAGATTGACCTCGTCGCTATCAATATCTAAATCGACGAGACTGTCATTTCAAGCATCTTAGAGCTCAAATCTTGAGCC
AAGTGATTAACTGCAGGTTGCATGTTTCCTGCATTATTAAAGCTGTGGCCTCACGAACAGCAGATTTTCTTCCGTTAAGCCAGTGCTGAAGATTTTTGTA
TTTTCCTCTCTCCTTCCAGGGCGTAGTCAACGTTCTACGATCCCGCAGCCGAACACCTGGACAAATTTGTGAGCCTATAAGAAGCCTCATGATGAGACAT
ATTCCGGTTACTATCATTTAAACACAAATAGAGGACCTCTTAACCCCCCTCCCTCCGGTTACTATCATCTATAACTGAGATGCTTCAAGAAGCGAAGAGA
GCAGGTCGCCACCAATCTACAAACGGAACAGCTTCCGTATTGCTGGGCATACAGATACCTCGCCCACGGACTTTCAGCGATTCAGGTTTCACAAAACTGG
AAATCGTCTTTCTATCCTGCAGAGCACGAGCGATTTCCGCGTGAAATTGACTGTCAAACAATACTACGAAAAACCTGATTGCAGTGTTTCCCGGGTAGAA
GTACCAACTTGTAAACACACGGCGATGCGGGAGCCACTCCGCACGGAACTAAGCCGAGTGTATTGATGGGTTGATAGCTAGATGGAAAGTTGAGAAGTGA
GGTCCGGGTCTGATGGTAACCAGCACGTCACGCACGCTCTGCTTCTGGCCCACAGGCATCCCCAAGGCTGACGAAGAGAGAGATGGAATGTAGTGGACAG
AATCCGAAAGGCAACATGCACATCGACATGCTAAGCTCCTGATGTAGGCCAGGCCAGGCACTGGCAGCCAGACCGGTAGATAATATGGCGCCCCACCGCC
TGAGGCTGGCGACTGTCTGATGCATCTGGGTTATCTGTGATCACGTCTACGCTGGGGTAGCTCCGTCCGTAGGCATGGTGATACCAAGATGAAATATCTG
GCATCTACTACACCGATACTGATAGTGCTTTATCAAGGATAGATGGCCAGAGAAATAGCCCCTAACGTTAGTACGGAAATGTCCGCTAAACGCTGTTTAT
TAAAGGTTGGATGGTCCACCTATCTCCGGAGTTCGTCTCCAGAGACCTACAACTAGACCTATAAACGGCAATTAGGGGCGGGACAGCACGTATGACAACA
GCGTAGGAAATATGATAATCAATTTTTCGCTGATGCTAAATGAGAGATGATCAAGCCTATTCTTTAGCTCCTGAGTCAGGCGCATTAACCTATTCAATGA
GCGTCTCCCCACGAAGATAGCAATGATTGAGACGTTCTCGAAGAGCAACGGTAATGTTGCTGGAGGCGGCGAAGGAGGTCCCGCCTACAGAGCATGCACT
TTGTTGGAAGGGGGTTACTTTTTCAAGAACATGTTGAATCTGGATCCGGCGACAGGACGCGAGAATTCGTACCCAATTAAATTGTTCTCTTTTAAAAGCC
TGAATAGTTTACCGATGGTTTCGTACCTGATAGCTCACTCAATGAAAACGAATTTTCAATATCAAGGTTGTGGCCTTGAAGATAGTTGAGCGCGGATATA
CGAACTCTGATATCATTTCGTCGAAGCACGCGCATGTTGACTCCTACAGGCCTTCAGTTTCTCTTACTGGTTTAGAGCAGAATGTTCCGGGGAGGCTTGT
CAGGTTTGATATTCTTCAAGCGCAATGAAAGGTTGACAAGAGCTCCCGCCATTTGAAAAAGTATCAATCTGAATCTACGTCACAATTTGTCAAAGTGGTT
TACTCGTCTCGCGAACGTACGATGCGGCCAAAAGTTTACAGATTTCCGGCCAAAAGTTTACAGATTTTCGAGTTCGATTTTCTAGGTTGTTGTATCACCT
TATGCTGAAGAAATGACAAATGTAGTTGCGGGAGGGCGATGACAATTGAAGAACAGTATTGAAATGAAGTTCCGTAGGATATTTAGGGAGTATGATAGCT
GAATAGACCTCAGCAGATAAGGTAAGAAATTACCTCCCACACGTCGAAATCGCTTGAATAGACGCAACTTGTCTAGTGGTAATCATAATCTAAGATGTGG
CCGGCAGCATCAAAGCTGCAGTTGCCTCTGGTTAAACTAAGGGCCCCACTCTCCGACCCAACTGGCACGCACGTGTTCTCAACGTGAAGTTCACATACAG
TACGGAATTATTTTGCGCCACGCAATCACCGTGGGGAAATGACGACCGTCCTTTGATGAAATCAGGACTCCCGATTATGGCATGGTCTTTTACATAATTT
CTTATGAAATCATAAATATATTTATTTTCTGGCAGACTTGAAGACCATAACATTATTTATTGTGGAGGCACCGATGCATAATTTATAAAGCTCGGCCTTC
ATTCTAATGAAGTCGTTCAAGCCGTCAAATCATGGTGTCATTAGAACTTCTAAGCAAAGTAGGTTTTTATTCTCGCACAGACCTCTCCAAAGTAAGAATT
TCATGTTTTTGAGGGTGCAATGCACACTCCACTAACGTGCCATTATTTGCTGTTCGCAGCAGCAAGATGACATAACTTATGTCTCGACTCTCATAAATAA
AAATTCCATCATCGGGAGCCCTGATTGAAAGCTTCAGCAAAACGCGATCGCAGGGTCCCACAAGTTTTGTCGAGCTGCAGCCAGATCCAATACAGTAGCC
CCCACGAACTGAATGACATGCGTGGCTTGAACACATTGACGGTCACAAATGCATTGCGCCAAAACTTGAAATTCCCAATCGATGTTGGACGGAATTTGAG
GGACGATGAGGGATTTGTGTTATTTAACCTCGGTGAGTTGTGATAACATAATAGACGACACGACTGTGAACGACGAGCACGATGGGGACGGCGGAGCTCG
TTCATATAACTGAGTCGACTCGCACGTCGTACTCGGGCTGCTCGATTAGACGTGCTCAACGCGATGGCATCTTAAATCGCGTCGAATTCCGCGCAGGCGC
CCTTAATGCATACACGCCAAAGCAGCAACCTATTTACCATATACCACGTAGAGCTACACGTACAGTAGTAGCAAAATCCCACGCCGTATTCGGGCAGTTC
GTGGCAGATGCTGGCGAAGACGACGAGGGCGGTCGACAGGTCCCCTGTAACAGTCTTGCGCCGAGGAAGGTCTTGCTTGGCGTGTCCGACGTGCGGTCCT
TGGGTAGGCAGGTGACGAGGTTGGTGGAGGGGTTGTTGCTATTGAAAGCAAATTGAGAAGTGATTGAGATTGAGCTGTTTGCTTTTACGGATGTCCTTGA
GACCACTAGTGTCCTACCCTAAAGCCTATCCTTCTCTAATCTCAGCTGCTATCTGTTCTACCAATGATCTTGTCTAAAATATCCACGTAGTTGTAGTTTC
ATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGATGATTTAGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTCTTATCCT
TGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGAAAATTTATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCTGACGGCA
ACTGCGTCACATGACCTCCCTTCAAGAAGACGCCTATTTTGAAAATGGCTTCGGTCGCTTCTTGGATTTCCAATAGAGGTCGATGAGCCCAGGAATCTGC
TTTAGATTCTCAATGGGTTCCCAGGTTGCATCAGCTCTGAATTCACCTAGCCACCAAATCTTGTACTGCGGTTTTCCCTTGTACATGCGGTGATCAATCA
CCGCTTCAACGAGTTGTCCTTCGGTTCCATCGGCTAACACGACTTTGTTCACCTGCTGCCTTCGCTTTGGGTCCTTGCGATACGGTTTCAGCAATGATGT
GTGGAACACAGGATGCAACTTTAATCCCTTCGATAATCCCAACTCATAGGAATCTTTTGAGATCTTCTTTATCACTGGAAAAGGTCCAATGTATCGTGGA
GCGAGTTTCTTCGACTGGGCATACCCCTTGTGACGGATATCCAAATTCTTTCCGTCTAAAAGCACCATGTCGTTGACTTCGAAGTTCTGGACAAGTCTAT
TCTTGTCGTAATAATACTTCATACGCTCCTGCGCCTCGCTCATACGGTCTTGTGCGACCTTGAGTAGAGTCTCTTGCTGAAGTAAAAACTCTTGCGCTGT
TTTCTCCAATTTCTTAAACTCCGGATCTGATGCCACATCGTCTGGCATGTAGGGGACATATCCTAGATCCGCTTCGAACGGCGACATTCGAATCGTGGAG
TGTACACGTCGGTTGTAGGCAATTTCTGCCAAATGGAGATATTCATCCCAGTCATTTTGAGCTGGGTTGACGACACCTCGAAGATAATCTCCGATAAATC
GATTTGTCCGTTCCGTTTGTCCATCTGTTTGGGGTCGGAAAGCCGATGACAAGTTGTGCTGCGTACCAAGCGCACTCACAATACTCTGCCAAAGTTTGGA
CGTAAACTTGGTGTCTCGATCGGATATAATGGTTTTGGGTAAACCGTGATCCTTTACATAATTCTTCATGAACACGTTAGCGATATCTGTGGTGTTGTCC
GTTGTCTTCGTCGCAACGAACTTCGCTCGCTTTGTCAGCCGGTCAACGATTACCATAATCGCATCGCAACCTTTGGTGCTGACAGGCAGTGACACTACAA
AATCCATTGAGATGTCTGTCCACCTACCCGAAGGTATGTCTAGTGGTTGAAGTAGTCCCGGCGGCTTGGTTTGTCTCGCCTTGTTGCGCTGACACATTTC
ACATGTGTTGACATAGCGCTGGATGTACTTCATCATCTTCGGCCAGTAGTATTTCTCGCGTACTGCCAAATAGGTCTTATAAAACCCTGGGTGTCCTGCT
GCTACTGCATCGTGATTCTCGCAAATGACTCGATTCTTCAGATCTTCGTCATCAGGGATGTACAATCGTGGAGTCTGGTCTTCCGCAGTTTGATAGAAAA
GAATGTCATCCTGTAAGGAGTATTTAGGCAATTCATCCCCTTGCTTCAGCTTCTTGATGATCCACTGTAGATCCTTGTTCCACGAATACATCGACTTCGC
CGTTTGGGCCACTGTCACCTTGTTTGGTACAATCGTTGCCACAATTTCACGATTCTTGGCTGCTTCCAGTAGCTCTTGTAAGCTTACTTGAGCAGCTTTC
AGTTCAAACTCTGGATTTCGTGACAATGCATCAGCCACGGTATTCGTTTCTCCGGGAATCCACTTGAACAAAGGCTGGAATTCAGCAAGCTCATTGAACC
ATCGTGCAACGCGTCGGTTTGTAGTCTTCTGAGTCAGAATCATCTCAATACTTTTGTGATCCGTTTCGACCGTAAACGGTCGGTCAAGAAGATACACACG
CCATACTCGAAGAGCATGCATGATCGCGAGCAACTCCTGTTCTCGAACAGGGTAGTTTAGTTCTGCTGGCTTCATCTTCCGGCCAGTATACGCGATTGGA
TGCTCTAGCCCTCCCTCCTTTTGAAACAAGACTCCCCCGATTGCAAAATTCGAGGCGTCCATGCGAATACCAAAAGGTTTTGTGAAGTCAGGAAGGCCGA
GAACTGGTGGTGAGGCTAACCGGCGTTTAAGCTCTTTGAAGCACTTGAGTTGATCGTCCGAGAGTTCAATAGTCTCTCGTGGACGCTTTCCCTTGATGCT
GTCATGAAGTGGTCCTGCAAATTGTGCAAAGTCCTTACAGATGTAACATTCACAACATGGATCAAGTACACTGTACATTAAAAAATGTTTGTACGACCGG
ATGCCTGAAGACCTTCCATTCACTAGCCAACTTTGAATCTGCTCAGGCTGTAACTTGGTTGCAATCTTTTCGGTCGTGGGGGCCCAATCAGCATCTGGGA
CAGAGCTTCGTCGCCCTAGTTTTAAACCGTCAAGGTCGGGATCACCGAAACACTTTCCGTATCCTTCACATTGAATTCGTCCATGTACTTGACTTACCTC
ATGAACTCCGGGTTATCCAACAGCTTGTCCTCCGCATTGGTTAGCTTCAACCTCGCAAACGCACTTTTCGGAGGTCTTCCCTTCTTGACTTCTTGACCCA
ACGTCTTCTCAGTGACTGGCGCTGATGAACAAGGTTTCAGTTTCTCCAAATTTGAGACAGAAATACCTGTCCTCTGTAGTCTATGGCTGGCCATTTCGAC
ACCTTATCCATATACTTCAAGTACCAAGCTTCAATATATTCATATTATAATAGGGTAGGTTCATGAGAGAGAAAGCGCACAGGCTTTACAAGCAACGTAC
TACGGTCTTTCGCAACTGCGTGGACGAGTTAGATCGTGATCCCTCTCAGATGGTACGCGTTGTAGTCCTCCACGTACTTCTTCCAACGTTTCCAGTTCGC
ATCCGTCTTTTCTTTCACGTGGAACAGTGTGGCAACAGCGGCCGGGTCCTTTTCTGCGAAGATGAACTACGTGAGCACCTCAGTCTCCAACTTGTTTGCC
AGATCCTTCGTTTTCGGGTTCTTTTGTGCCGCTGTAATGGCCTTTACCAAATCTTCGTCCTTGTAGATAGTCGCCAATACGGTCCGAGGAACAATCTGAC
CAGGGAAAGACTTGTGGAAATCATCCATGAACTTCATCCAATATGCGAACATCGGGCTTTCGAACAGCTTTGAGGGCTTTATCCGATCTAGTTTGAGTAA
CTTGAAGGCGTCACCCGGTGACTGCGACCTCCAACGTGGTGGCCACTCCCCTCGTCCCCGCGACCTTCTTCGCAGCGTCGAGAATCTTCGCGACCGCTTC
GTCACCGTAGTAAGTCGTAAGTTTAGCGATCGCTGACGTTGTCTTGCCAGGATTCTTGGCGGTAAAATCGTCCACGTACGTAAGCCACGTCGTGAACGGC
GGGTTGTCTAGTAGTTTATCTCCAGCCCTCGTAAGTTTCAGGCGAATAAAGACGTTGTCGATGGACTTCCCGTTTTTCAGCCAGGTCTGGAGTTTCTTCG
TGGTGGCAGTCGAAACCAACGCTTTGGCCTTTTCAATAACGAAGCTTGGGAGGTTCACTCTCTCTTCACCGTCGTCGTCTCCGTGAGCGATGAAACCCAA
CGGTAGCGAGCTGATCGTGATTCGCGATGTGTAAACGGGCCTGAGTCAGGGAGTCCGGTTGAATAATCTCCGATTTCTTGTGTGCGGTGGCCGTATCGGT
ACTGGCCAGGAGTGCGACAGCTAGCAGCCCAACGCAGCTCAGACGCATCGTTCTCTTTGAGAGTACCGGTACTCGGGAGAATGTTGAGTAGTAATTAGGA
GAGCTGTTCACGGACAACTAATTTGTGGAGCAAGAGCCTCATGCCAAGAGGATGACCACGTAATACTCCAGTACGGGTGTTTACCACACAGCCTACATAA
CAGAGGGATTTCCGATGTTTTTTACCCAGCCGATCCGAAATGTGTATCTCTGAGGAGAGACTGTCGTCACGACAGTGTGGTCACCAGTCTCTATTGGCAT
ATCTTCAGGTAATGATGTACATGTAGGTATTGTATCGTACCAAGGAGTACATGCACTCATGCAAAGTGCACAGTACATCTTGCTGCAGTTTTGGGTTTGC
ACTCGGTAAATTGCAACGCAGTTGTATAAATTCGACTCGGACTGCGTTGTACTTACGTTATTTGAGAAACAGAACTTTGGAGCAACTCGCAAACGTCTTA
CCTGAATTTATCAGGAGTTTGCACCAATGGCCAGGATGGCGCAAGAAACATCACCTTACGCAGTCGTTGTTGCCCAGTAACTTGTTGTTGATACCCTCGA
GTCGGCACCAACCTATCGGCGTGGGACTATAGTCATTGGTTTGCCTCCATTGGCGTTAGGTCCGGCCAGGCCCATATCCTCGAGGAACTTGTCCATCCGT
GCGGACTCCTTCGCCTAGAATTAATTGCAACACACAATACGAAAAGACTGAGCAACTCACACCACCAAACCCGTCATTTGGAAACGCTGTACCTTCAGAC
CCGCGAGCTTCTCTTCCTGCATCTCCTGTTTGCGGCGTCTCGTCGAGTCACGCTGAGCCATCCGGCGCTTGAACTCCTCGTCGCCATCTCCTCGACCTCC
GCCCATCAGAAAGTCTTCGCTCACATCGAGGCCATCCCGTGCATCATCGCGATCTCTCGCCGCACCATGGAGCTTTTGGCTCAGTTGTCGTCGCTTCTCA
ATTTGAGCCTCTCGTCCTGTAGCTTTGGGTGCCAGTTCGTCCATGACCGTATCACGATATTCTCGTTCTCTTTTCTGGTCCAGCTTGCGACGTCTCCACT
GCTCCTCCTTGTCTTCTTCGAGTTCCTTGGCTCTGCGTTTGCTCTTGCTGCTGTCCCTGTCCTCCTCCAACTGTGGGCCCTTCACACTCTCCCGCTTACT
CCCCGAACTCAGCAGATTTTCTCTCTTTGTGGCCACATCCACCGAGTCTTTAGCCGTCGCCAGCTCGAATTTCTCCTTTTCTCCCAGTTTGGCGACGAAC
CCCCAGCGATGACGCGTCCGCTTGGTCTGCTCCACCACCGCGTCCGGCAAACCTTCGTAAAACATGGTGGACAACTTGCCCCGGTTCCATTTCTTGGCAA
ACTGGTCCGTAAACAGCTCGGTCGCCTCGTCCGTCGACAGATCATCGACATATTTGCCCCTGATAGAAACAGGAGATCATAACATATCAAGAAGAAAATA
AGACCAGATAGTCTCTTTATCTAAAAGAAATAGCAACGCACTTTGTCTGTGCGAGCCACACTCGGAACTCCGTCTGTCGCAGAAAATAGTCCTCTTCCGA
GATTTTGTTTGTGCCTTTGGGCAGTTTTGTGTCCTCATGGCGACTGGTTTTGTGACTTTTGTGGCGCTCGTCCTCGGACCGGCGGCTGGCCTTGCGACTG
GAGGAGGACGAGGGCTTCTTCGAGTGCGTGTGCAGCTTGCGGCCCCTGTCGCCTGTAAAGAAGACGAAGACGTTAGAAGAGCCCTGCAGGAGAGGAGAAG
AGAGCGAACGCACGATGATCTCGCCCCATTTTGATACATGCAGGTAAAAAAAATTTGTTTTTGGCCAATCGCATGTTGTATATCCTACAAACGTATCTAG
AAAAGCAGTTACTGTACGTTGTGATCGTTGACGACATCGCGTTTCGATGTCGTGGGCTGCAAACAGCGAACCAGAGCATCGGAGCGATCGTGGTGGATAC
TGCATCACCTGTTTGGAGAACCACACACTACAAAACGCGGTTGCAGCAGTACTCGATTCCCACCGATTGGCAAATATACGAAAGAGGTGCTCCGCCACGA
CAGCGTACCTGTCAGGTGGGTGAGTTCAAAGGAAAACCCGGCAGAACTTTCCAAAATGCTCAGTGGTGTGGATACCGCTGATGAAATGATCCAGCGATAC
ATCAAGATAGCCAACTTAGTGTAGGGAAGCATCACGCAAGTCCGCTTTGGATGATGATGCAGCTAATATTTGGTCATGATGATACCGGTAAGTGGCCTTC
TATTTGATGTGTATGTTTCCTATCAATGTAGTAATAACATAATTGATCTCGCTCGTCTGTCTTGGAGGGGTTGTATCCAGTTGATCTTGTAGCGTGAAGG
TGGAAAGGTATTCCTGCATCGGGTCCGGGGTTGCGTTGGGTTGTTGTAGGTGGAAGTGTCGAGTCTTGTGTGTGTGTTTGCCAGTGTTTAAACTGCTTCC
AGGTCCGCTTTTGCTGGTGTGCTCCATTACACGACGAAGAATCGCTGTAGCACATGACTTAGTTCCTGGGCGGGGCTGTCGCTCACGGTTGTCTCTGGTT
TTGCACTGAGGGCTCCTTGATTGTTTTATCCACACTGATGCAGGTAATATTTCGACGCTAACCTCAATAGTTTTGTAGTGTCACTGCAATGGACATGGGA
ACTGCTCTTTGCTTTGACAGGTTGACAGGCAGTAGCGTACTCCGCAGGTTGTGCACTTTTTATTAATAACTCATTGTGGTGGTAGCAAACGCTTGCCAAG
GGTCTTGCGAGCGCAGGCACAGCGTGAAAGTGAGCTCCGTTGTCTATGCTTATGATCCTGCTTCCCTGGCCTTTGCATTACTACATGTACTGTACTGTAC
AGACGTTCCTCTAGGTCGTGTAGGTTGTAATGTAAGCAGCTGGAATATCATCCATCGAAGGTGCTTAATTAACTATGGAAATTATCCGTTCGTCCAATGA
CGCCCCCAAAACGCACCATCGGCCTCTGCTGCTTGCGGCCAATGGTCTCAGGGGAAAGCCAGTTCTTGAAGTCTTGTCTCTAGTCACTTGTCCGTCATCA
TGATGACGGTGCTCACTCATGAATGTGTTACCTGTATTTCAGGATATGGGCTCAAACTTAATAAAGAAAACATAACATAAAACTCGTTGAGACAGAGCAT
ATTATCCGGTTCTACTCGAAATTTCCGCGCGTGGCTGATTCAATCGACCCTGACAAAGTGCTTGACATACTGGTGGACACGGTGCCGCTGCGCGGGACCT
CTACATGTGCCTGCCGGTTATACACAAAGCGCCCGTCATAAAATCCCTTCATCTTACTATGCAGTAGGCATACCAAGTACGGGCTCGACTTGGTAGAAAG
CCACACAGTTTGATATCGGTCGATTCCCAAATGGCTTGGAAACTATCGTCCTGAATCGGAAGGGTCTCTCGATTCGCTGCATAAGCTGGTCCTTTCATCA
CCGCTGTGCTACAGTGCTACGTTATGCGCACCTCGGTGTTCCGATACCGCGTCATATCTGTTTATCGCTGCTGGTGGTTATCGCCCACTATTGTGGCCGA
CTGCCCGTAGCGCTGCCAGCGAGGACCGGGGAGACGCAAGTCTGGATCGGAAGATAAGCTGGGCGTTATGTTAGCACAAGGATGGCGACTAGGACGGACA
TAGGAAGTCGTTAGCGTAGCTAAATGATACCCATGTACCTTCACTGAAAAACGAACACTAAAACTTATTGCCCACTACAAAATAATGCTATAACAATACT
CAGCAAACCAGTAAGAAGGCTAGGACAAGGTGAATAACATGTGCAAAGCTGCTATTTCTTATTTTTTTTCGTTTTTCAGTGGCGTACATTGATGTCACTT
AGCTGCGCTAACGACTCCCTATGCCGCCCTAGCTACCGTCCTTATGCCAATAAGTACCCCATGCATTGCATTAGGTAGTTACACTCCGATCTGCATGTAC
CATGATCACTCGAACACTACCAATACGATTGTCAACACACACACACACGATCTCCGCTCTGCTTGTGGTCGATCCTGCAATTGCTACTGCAAATGCTGTT
ATACGTTTTAAGAGGTTACCCTGTCCACGAAGCCGTGTAGCAATGCACTGGTCCGGATGGTATGGTATGCTGGGAAACAGATGCTCAACCTTTCTGGGAA
GAATTTACAGCTGCTCCTTGACCTTTCCAGCTCGAATGGTAATTTCATTCACAAACTTGCCCTCTAGCGCTCCAGTCGGAGGATGCACCGCTGTTTGCTT
ATTACGTTGACTATATCGTCCGTGCTTCTAAGCCTCGATGCCAGTGCAGCGGCGCAACATTCTGAACCAAGCCTCGCCATTGTTTCCAGCTCGCATCGTC
TCGTAGTTCCAGACAAGATCGATATTGTCCCCGCGGTGAGATTCTTGAGAGCTGGCCATACGGCGCCTGATGAAGGCGAAGAGAGAGCGGGGCTCTCCGT
GTCCATGGCCGAGAAGGCTAAAACGTTTCTCTCCTCGTCGACAATCTCCACCGAAAAGCTCCAGAAATGGCTCAGCAGCGGCAAAAATGCAGACACTGTT
TTCTCGCGCATGCAGCTTACCAAGGCTGGGGATGACCTGCTTTCTAACCCACAGTTCTCCGTGTGGATCAAGTACGTGGATGATTTGAGCGCCAAGTACC
CAGCCAAAGCGACGTCGGCGATCTCGACGCTGACGACTCAATACGGCGATGATGCACTGTATAAATTGCTGAAGCTGCAAAGAGTCCCAAGGACAAGAAA
ATCTCGCCACCAGGCTGCAAGCCGAGCAGATGCAGCACTGGGCTACCGTCGGAAAGTCCCCTGACGACGTCTTTCGTCTGTTCGATCTCCAAAAGGCAGG
AAATTCCATTCTCACAAACCCGAAGTTTACCTCATGGACCACATATGTGGACAACGTTAACGCACTGAACCCGGAGAAGGCAGCATCAACGATCCCAACG
TTGACAACTTACTACGATGATGATATACTGTTCAAGATGCTTGATGCCGCCAAGAAGTCGGACGAAACAAAGAGCATCGCCACCAAGTTGGAGGCCCAGC
AGCTTCAGGGATGGCTGAAGAGTGGGAAATCGCCGGATAATGCGTTCGCTCAGATGGGACTTAGCAACGTGGAGGATAATCTGCTGGCGAGTCCGCTTTT
CAGCACTTGGGTTAAGTACCTGGATGATTTCAATGCGCAGTACTCAGCGAAGGAAACAACTCTGTTTCATGTTTTGACGAAGAGGTTCGAGGATGAACCT
TTGGCAAAGATTATTGCTTTCGGAAAGACACTGGACAGTACGAAGGCAGTCGCAGCAAAGTTGGAGACCCAACAGAGGCAAGTCTGGCTGACTAGTGGTA
AATCATCGGACGACGTCTTCACGCTGCTGAAACTTGACAAAGCACCAGACAATTTCTTCGACAATCCGCTGTATAAGACGTGGGGCTCGTACATGAACCT
CTTCAACAACAAACATCCGGGGAAGCAAACGAACTTGTTCAAGACGTTAACGACCAAGTGCAAAGACAAACCATTGATCAAAATCCTCGAGGAGGCGAAG
AAGTTTCCGAATCTCGAAAGCACTGCCAGCAAATTGCAGACGGAGAAGATCCAGAGTTATCTCGCCAGCAAGAAATCTCCCGATGAA