Description :
From Genome Similarity Track
Location :
Scaffold_1654:1376- 2727
Transcript NameFunction/comments
Phymu_g13520hypothetical protein PHYSODRAFT_330122

Sequence
1351 bases(100 bases per row)
CGTTTGTGGGGCACGTGTGTCGTCCATCATTTGCGAGGAGCCTTGGAGTTCAACCCCTGACAATCCAACGCTACAAGCAGCGCATTCGGGACGGCAACAT
CGCCGTAAAAAAGCACAGCAACCAGCTCAACAAAAATGCGTCCAAGGTGGATCTCGTTTGGCTAGTCAAATGGTTTCAAACCTTTGCATCAGAGGTTGGA
GAGGTGGTACCTGTGCGAGTCCGCATGCAGAAGACAAAGGACGGAATGGTGAAGAAGTACTACATCCGAGAAAACTACACACTCTTGCCTGCGACATGCA
CATGGGATACTTTGTACGACGAGATGCACAAGTTCGTAGAGCGTGGCTTATACGTGTATGAACCAGCACCCTCAACGTTTCGCAAGCTCCTGTCACTTCA
CTGCCCGACGATCAAGATCCGATCCTCGCAGTCGAATGTTTGCGGTTTTTGCACGATCTATCAAGCTCATATGCGCCGAGGACCAACAGCTGAGCAAATG
GAAGAGCTAGGACAGCACACAGAATCAGCAAGGCGAATGAGGTGCGTGGACACAGGTATCAATTTGTTCTATCATTGATTTCTAATGAGGACATGAGTAT
CCTTTTGATTGTTTTGGCTAGGCGAGAGTACAAGAAAGACATTGCTGACGCTCACACTTCCGACAGCACCACGCCGTGCAAGTGATGGACTTTTCGCAGA
ACCTAACGATACCGTCGGTCACAACCACGCCATCGCAATGGTATTTCTGCTCTTTCCTCGAGGTAAACGTGTTTGGGATGTTCTACGAGAACGAAGGAAC
ACAAACAAACTATCTGTACGACGAATTTGGTAGCGGAAAAGGGTGCGACCAGATCAACTCTatgctccagcacttcatccGAACGGTGTTGGTTCCGTCG
GGCAAGAAGCGTCTGGTGGTGTACGCCGACAATTGTTCCTGcgaaaacaaaaacaactACGTCATCCGCTTTTTCCGGGTACAAGTACAGATGGGGACGT
TTGAGCGAGTGGATTACAAGTTTTTTGTCAAAGGACATACTAAGAATTCCTGCGACGGTGGGTTTGGGCACATTCGAAAGCACATGGGCCGCTCAGACTG
CTGGACCATGGACCATGTAGTTGCTGCGGTCAACGATGCAGCTGCATCCAGTCGGACGGTGCACATTTCGCGCGGCAACTGTTTTTTTAAAAGCCACAAG
CCcttgctggaagagctctaCAAAAAACTAGTTGGGGTACAGCAGTACCAGATTTTAAGCATGGAGCAGGGCAGTCCAGGCGTGGTGTTCTGCAGGAGAG
GACCAGACGATGAACCTGTTGAGAAGGACCTCCGCCGCAAGGTAGATGGCA