Description :
From Genome Similarity Track
Location :
Scaffold_14:1375979- 1377449
Sequence
1470 bases(100 bases per row)
GTTGCGATGGAAAGAAGCCATGCTTGCAGAGTTGCAATCACTAAAGAGCCATAAGACATGGAAGTTGGTACCACGAGCGGTAGCCAAGGGCGTCAAAGTT
ATCACGTGTCGCTGGGTGTTTGCAGTCAAACGAGATGAGCGTGGGAGAATCAAGAGATTCAAAGCTCGTCTCGTCATCCACGGCTTTAAGCAGCGCCTGG
GGGTGGACTATTGCGAGACTTATGCACCAGTGATACGATTCGAAACCATTCGGACTGCCATCTACTATGCAGTGCAGCGTGGCTGGGAGGTTCTACAATA
CGATGTGAAGACTGCATTTCTCTACGGAGATTTGGAGGAGCTCATCTTTATGGAACAACCGCCCGGCTTCCAAGTGGACGGACCAGGCTTTATCTGCAAG
CTCCTCAAGAGTTTGTACGGTTTGAAGCAGGCACCGAATATCTGGAACAAGACACTACACACAAAGTTGATGACGATGGGATTCGAACGTATGGACTCTG
ACTATGGTCTGTACGCACTGAAAGAGAACGGTGAAGTGAAACTTTTGTTGACAGTTTACGTGGATGATCTACTGCTGATGGGACCACGTGAAGTATGCCT
GGAAGTTGCTGCTTCCTTGCAGAGAGACGTTTGAGCTGACTACGATGGGAGCAGTGAAGTATCTCCTGGGAGTTGAGATTCTCATTAATCGGCCGCGCCG
ACAGATTATCTACAGTCAGCGGCAGTATGTACTGGAGATCCTCAAACGTTTCCACATGTCGGATTGCAATGGGTGTGCGACACCTGAGTCGGCGACCCTT
CGACAATGGCTGTACCTACGAGCAAGGAATACCTGCCTTATCGAGAACTAGTAGGTGCATTGCAGTACCTAGTCAGTGCCTCGCGGCCTGACATTGCACA
CGCGACGCGACATCTTGGCAAGTTCCTAGCGAACTACAATCATTCACACTTTGCCCAAGCCAAAAGAGTACTACGCTACCTCAAGGCTACGAATAATTAC
GGACTTGTGATGGACGTGCAACTTGGAACGAGTGTTCGCATTTGCTGCTATTCTGATGCCGACTACGCAAACGATCCTGCTGATCGCCGCAGTATCAGCG
GTTACGTTAGCATGCTGGATGGCAATGTGATTTCCTATGCTTCACGGAAGCAGGAGATCAACGCACTAAGCACGTGTGAAGCTGAGTATGTGGCGATGTC
AGAAGCTACCAAGGATCTACTATGGTAGGCTGGTCTATGCAATGAGCTAGCCTGGAAGCACCCAACACCTTTGCTGCTGGGTGACAACGAGGGAGCAATC
TCGTTGAGCACCAAGCCAGGCAAGCACTCGAAGTCGAAGCACATCGACAATAAGTACCACATGGTGCGGCGTAGCGTGGAGCTAGAAAAGCTCACTACGC
AGCACGTTGGTACTAAGGACATGGTGGATGACACGATGACAAAAGCGCTTGCTGTCGTGAAATTTGCGCA