Description :
From Genome Similarity Track
Location :
Scaffold_374:13758- 14885
Transcript NameFunction/comments
Phyke_g9680Avr4-associated TDF-like protein

Sequence
1127 bases(100 bases per row)
CTCACAGGCCTGGGTGGACGCCAATGTAGCCTGGAGTCGGTTCGCCCTGCACTTCGCCGAAATACAGCGCGAAAGTTTGCTTCCAGTGCTCTACCTTCTC
ACGGTCAGCCATAAAAGTCGGGAATGCGTCCAGGTTAGCCTCGGGGACTTCCCAGGCATGGCTTGCTCCCGCGGGTGCGATGTCGGTTCGCACGGTATCG
GTGATAATGGACGACTGGACTTCCGAAGACAAGATCCAGTTCATGAACAGCTTCGCTGCGGCGGGGTTCTTAGCCTTGGCTAAAATGGCCAGGCTCTGGC
CCCACGTTAAGTATTCGGTACTGTTACCGCCCACATACACAATCGGGTTAGCGCCACCATATGTACCAACGCCAATGACCTTGTCCTGCGCGAGAACCAA
ATTGTTTGCCACGTGGGAACCGCGGTTAAAGCTGATACTCTGGTTAGCCATGGCGGCAACCCAGTCCCAGCCGTACTGCTCGGCGTACAGGTGGTAGACG
AATAGcacagcgtcgtcatcgtGGGGGTACGACGAGGCGATTTTACCTGCCCATTGAGGGTCCACAAGGTCAGCCGGTGAAGTCGGCGCGTCCAAACCGC
CCAAATTACTCGAGTCGTAAATGTAGCTAAAGGAATTCACGCAGTACGCAAACCAAGCGCCATTCTCGTCCCTCAGACTTTCGTAAATCTTGGAAAAGTT
AGCCGGCTTGTACTCGAGCAGGTCTCCTGCCTTGGCCCAACGCGGGAAGTTTTGCACTGTCTGAAGTGCCGTGATGTCTGGCACAAGCGTGTCGGTCTCC
AGTTGGTTGTCGATGCGTACGTCGTGGTACTTGCTGTAGTCTACGATCATGCTCATGTTCATTCCAGGGAAGGCTTCCTCGAATGCAGCTTTCAATGAGT
CTTGCTGCGTCGCGATGTCGCCTCCGTGGTACATGACAAGCTTGCCGCCTTCAGCAATAGCGTCTTCGTACAGTTCGTTGAGCGTcttggtttcttcttc
cacagcGAGGGTGTTCGCAGCAAAGAGAGCAAACGCGGCGGTGATCGGAGCGAAAAACTTCATCGTCGAGGGGAGTTTAGAGGAACTTGATCAGCAACGA
GGAAATTTGAGAATGCATGAAGCTGGT