Description :
From Genome Similarity Track
Location :
Scaffold_88:137577- 144774
Sequence
7197 bases(100 bases per row)
TAACTATTACGGCCGATTCATCCAGAACTTGGCTGTTTATGGAGCGGTACTCTATCAGCTAAAGGACACGGACTTTGGTCCTGGGGGTGACTTGGCGTCG
GCAAAAGCGTCATTCGCCGAGCTCAAAGGACGGGTAGCTGAAGCTCCAATTCTGCGCCATTTCGACTCGGCGAAAGAAGTCTACATAATGTTGTACGCCA
ATGACTGGGCACTGAGCAGTACCATGATGCTGCCGCATGACGACAAGCTGCACCCAGTTCGCTTCTGCGGACGCGTACTAAAGGAGAATGAACTCGGCTA
TCCCGCTGAGAAAGAAGTAGTCGCGCTGTTACAATTGCTAAAAGTGCGCTACACTCTCTGGGCGGGAAAGACGCTACCAGTTTCTCCACGCTGGAGTGGG
TGTTTAAGTCAAAGTCGTTGTACGGCCGCGCAGTCAGTTTCGCAGTTATGCTGTCGCCCTATGATTTGAAGGTGAAACGACTACGTGAACGAGATGTAGG
CTTCGCCCAATTGCTCCAGGCGTCGATAACCCCGTTTATTGGACTCGACGATTCCTTGAAGCACCTTGTGCCTCCCTCCAAGAACTCGGCGACAGTTCGA
ATGGACCCAGAGCTGCTATACGCCCGAATACCAGCTGACTTTGCGGGATGTGTGCTGTCATTTGATGGCTCAGCGAAGACAGCTAAATACGGCGGGTATG
GCAATTGTTCGTGGATACTGTGGCGCCTTCCGAATTGGGACATTGAGATCGCTGCGAGTGCGTACCTGTCGTCCACCACAGTCAACATCGCTGAGTACAC
CGGCATGAACAATGGAGTCTTGGCGGCGATTGACCGAGGGATAACTGATAGGATTATCGTGGGTGACTCCCGGCTTGCAATCCAGCAATCCATGGGGGTG
ATAGCATGCAAGAAGGAAACGTTGCAAGTGGAGCTAGCTCGACACAAGGATCTCACGAAGCAACTCAACTCGGTCTGGTATCGACACATAGCGCGACACT
ATAACGCAGCGGCTGATTCTCTCGCTACAGAAGCACTTGAAGCTAAAGCTGGACGAGTAACTCTCGGGACGGATAGGAAAGCAGAACTGAGAATGATTAA
CCGAGTAGCCAAAGAACTGTACGCCACAGACAACCCAGCGGAAACCCCAATTGTCACGGCAGTCACTCGTAGCCGAGTACGCCGAGTTCACTTTGAGGAC
GAGCTGGATGAAGACTCGGCTAGAGCAAGAGGAGGAAGTCAGGATCACGAAGCCATATCAACAAATCCTGGAGAATCCGCGTTTGAAAGCAGTGGAGATG
AATTCGGACAAGTCAGCAGGGCGTCGACTCGGCGGACTAACCACACGGCCCGAATGTCGAAACAGGGTCGCAGATGGAATCAGCCTAGACAGCTCAGAAT
GCCAACGACATTGATCCAGTGACAGTACAGACTGAGCGGAGACGACGAATCGCGAAGGCACAAGACGAAGAACTTAGGTGGGCCGATCTTAAGGCGTACC
TGAGAGGCGAATTTGAGGACCTTACACACCATCGAGCTCAGAATGCCGACAAGGTCGCAGAAGTCTTTGTACTCAGCGAAGACGATCTGTTATACCGCCG
AGATGAGACGCGCCGACAGGGCGAGCTCGGCGAACCGAACCTCTCGTTGAGATTGATGATTCCGTTAGCTATGATCGACGAGATACGATCGAAGGGGGTC
ATAATGGCATCGTCAGAACTCATCACCAAGTCAAAGCTGACTACTACTGGATTGGTCTTTACGCCGACGTGATGAAACATGTTAGAGCCTGCGAGGACTG
CGGTACCAGTAAGAGCAAGCCACAGTTGAGAGGTTACTCGCCGGGAAATGTGGTGTCAGACCATCCATTCCAAGTCGTGTCAATGGATTTTGGGATTCCC
CTACCTCGAACTCAGCGGGGCAATACTGCACTGCTGTTGTTCCAGGACCACTTCACGGTGTTTGTTATCGCTAAGGCTATGAATGACACCGGGGCACTCG
AAGTGGCCAAGGTGTTTGAGGAATGCGTCTTCAGGCAGTTTGGAGCTCCGTCTCTGATACGGCACGACCGAGATCCAAGGTACATGAGTGAAGTATTCCA
AACGTTCTCCGAGATGATACAGTCGAGATCGAGGGCTACGCTGAGTTACCGGCCACAAGCCAACGGTCAACAAGAGAGGTCAGTCAAGACAATGGTTCAG
ACTATACGGGTCTACGTGAAAGACCCGCTTCAAGCCGACTGGGATGACATCGTCGAGAAGATGGTACACGCTATCAACAACTCAAGAGACTCGACTCGGC
GAGAGACCCTTTTTTATCTGGTACATGGCTGGGACGCCAAGTCTACACTCAAGGCTATGACGAGCTCAATACGACATGGTCAAAGACGCTCGACCGACTC
GGCGGATGCGGTCGAGTGGCACCGAGAAGCGAACAGACAAGAAGTTGCCCTACGGCTAGCAACTGAGTTCCAAGTGCGAGAGAAGGCACGACGATCTCGA
GAGCACAACGAAGCACTGAGCAAGAAGGAGAAAATATCCATTCCCAACACAGCAGATGACGAAGATGGAGTTGCAGAACCAGGCGATGAATCCACCGAAT
CCTTGTTCAAAGAGGGAGACCAAGTCTGGTTGTTTATGGAGCGAGTCAAGTCGGGCCTGACCAAGAAGTTAGCCCATCGATGGCATGGACCATTCAGGGT
GAAGAAGAAGGTGGAAGAATTCGCCTATGAATTGGAGTTACCCGACAAGAGTGGATATAGGTTCTACCCAGTGGTCCGTGTATCACGTCTGAAGGCAGTC
ACCGAACTCGGCGGAAGACCAAAGACGAGGCTTATCGCCGACCTCGAAGAGACTCAGCGATTTGACTTTGACGAAGAATTACTGCCTGAAGATAGCTGGG
AGCCAGACACAAGTATGAACCAGTATGAAGTCGAAGCAATCCTCGACGACGAGCTACCATTATCCACGATTACGTCCCGGTCACAACGGAAGTTTAAGGT
TAAGTGGGTCGGCTACGATGAGCCTACTTGGGAACCACTGTCGAATTTGTCATGTGGAGGTCTCCTGTTTGACTATCTACGACAGAAGAAGCGTGAAAAC
CGTCTGCAAATGGTGCAAGTTGCAGATGAGGATTAGCAGTTATTGCACCAAATCTTACACCAACTCAGCGGACGACACAGGCCGAGTTGAGATGGAATGC
TACTGTGTCGAAATTACATATACTGAATAATTACGATTTGAAGTCCTGAACGATACCTACGGGACGCCCAGTCAAAAGAAGAAAATTAAAAAGTTGGCGA
TCCGGACTCCAAGTGAGTTGAACCCGACGGAGACAACTGGAAAGAGCTCAGTAGACTCGACGATTGGAGGCGTGGCGTCGTAGCAGACGTCGGCCCTTGG
GAAACTGCGGAAGGAGTTGCAACATGCAGCCGTGGCAAGAAGTATCATCGCCGAGCTAGCTAAAGAGACTGACGCCGAAGCAGGTGGAAGAAGAACCGGT
GCCTCAGAACCCGACTCGGCTGTAGTGGGTTGAGGCGGATCCGTTCCACTTGGGAGTGGAGTGCCGAACAGAGACATACTCGGAGACGCGCCTCGGAGAT
TGAAAGAGCCCAACCCGTCGTCTGCTGAGTCGTCATCAGACGCACTTTCGTCATCCGAGCCGAGCTCACCGATTGAAGACCCAGCGAAGATGTGGATACC
TTGACGATTCAGCCGAGTTGGAGCACCCTGAGCGTATGCAGAAGGCGCTTGTTCGGCAAGATCGAAGTCTTCTTCAATCGCGTCGTCAACAGCCTGAGGG
TCCATACCGCGCGGAGCGAAGACCAAGAAGTCCACGTTCCGAGCGCGGAAGCATGTGCTATACGGGTGAACCGCCGATTCAGTTAGCCACCAAGCTCGCC
AGGGCTTGGCTAGATCCACATCGTGAGCACATTGAACCCAGTCTCTCCCGGATGGAACCCACGAAAGGTTAACGGGAGAGTAATGGGGACGGACGGATCG
AAATAAACCTCAGCGTTCACAAGAGGAGCAGGTTCATCGCCGAGCTTCTGAGTGACCGCCGAGTAAAGCTGGTCGTAGACAGCGACAACCAAGGATCGAA
GGGTATCACTACGGCGTTTACGCTCGCGCTTGTACACCAGCCACAGCTCATACACCTCAGCAAGCTGAGCGGGCGTGGGCCGGGTTGACGTCAGGATGGA
GACCCATCAACGCACTTGACTCGCCGATCCAATGACGACGCTCATAGAGAGCAACAAAGTAACGGGTCATTTGGCCATCTGTCTTGATGGGCCTCCCCGA
CGAGTCCAAAGGACTGTCGCCACGAAGCTTCACCCACATATCTCCAAGAACTTGCATCAAAGTTCGAGGTCGGGTCTGAGAAGCCAAGCACCGCCGAGCT
TCCTCCAGTACCGACGGAGAAAAGAAGAAAGGAAGCTCAGGGAGCATCCGCCGAAGACGCTGACAAGGATGGCTCGGATCAAAGACAGCCATGAAAGCTC
GTATGCCGTCAAGAGAACACGGCGTGGGTGGCACACGACTCTTGCCGCCTATGAGCTCCAGCTGCATCCCCCCGCTCAGTGTATCCAATAACGCATTCCA
ACAACGGGCTGAGCCGAAATGCATAAATGGTACCTCGCGGAGTTGAGCCATGTGAAGAGTCAAGCGACAATCCTTGGAAACTGCTTGCGAGGCCCGGGTC
CGTAACGTCGCCAGCGGCAGTGTAAGAGCGCTTGGCAGAGTGACCGAAGCCGGACGTGATGCAGTCGAACTCGGCTGAGAGGGAACCGACGCTACCGGGA
GCACACTTGACGAAGGAGCAGCCAAAAGAGATTGGGCAGGAGCCAGATCAGGAGTTGACGCAGGCTGCCGATGCTTGTGGTGCCGGTGCGTCTTGTGATG
CTTCTTGTGCTTCTTGTGCTTCTTGGACAGCTTCGACCGGTGAACGGGAGAACTCGACGAGGCACGACGCTTGCGACGCTGCTGCTTCCCCGAAGCCGAC
GCAGAGGTAGAAGTCGTCCCGTCACCAGAATTCATCGATGAATGACGCGAGAAATGACGATTACTCGGCGGCAAGGACTCATCACTAATCTCATCGTCAG
AGCCAAAGATTGCCGCATGAAGGCTTCTCGCCTTGGCAGAACGACGAGCATCTTCGGCCGCCGAGTCAGAACCTGAAGGACTACCCGCCGCGTTCTCGGA
TAAAGAGAAATGGGATCCAAGAGCGACCCAGCGGCATGATTCGTCGGGCCGGCGGACGGGGCAGAACCGTCGCCAGGTCCTAACACCTCGTCGTCAGACG
CGTCAAGGTCCTCAAGCAGCTGAGCAGTCACCGTGCGAGCAGTCGCAGCAGATCTCCGGATGGGGCGCCCAGACGGGGACGTCAACACCGCCGAGCTCGC
ACGGAGAGACGGTCTGAGGACACTCACGGCCGGAGTCACTAGGTCAGTCGGCGTAGTCGATAGGCTCAGACCCCGAGAGGGAGAGACGTGAGAGGATCCG
GCAGATGACGACTGGGAGTGCCCAACCGCCGTTGATACGACGCTGAGCGGTACACTTGACTGGGGCAACCCAGCGGAGATGGGCGAAGTTGAGCCTGGGG
CACAAACGCTTGTAGCCGGGACAGGCAGCGAAGCCACGACATCGAAAGAAGATACCGGCGGTGGGTGAGTAGCCGCGACGGACGACGTCGACAGAGGACC
GGAAGACGAAGAACCCACCGAAGTCGTCGAATCAATCGCAGGAACAGTGTCGGCGGCCGGTTTAGGCAACTCAAACTCGAATTCAGCTTCGCTTGAAGCG
TCATCGTCGTCTTCGGAGCGAGCAGCGACAGCGGGCTGTGTAGCAGAACTCAACTGAAGGTGACGAACCTTCTTCCACCGAGTCCGACGACGGGATTTTC
CAGAGCGGGGCCTTCCTCCATCGGACAAAGTAACTTGAGAAGAACTTGAGCGCAAAAGGGCACTGATAGCCTCGTGTCCATCCTACCCGGGAAGTGGACA
AGCGTACGACTGAGGCGGATGCGGCGCCGGTGGACGATGACGAGGACCTGCAGCAGTTGGAGACTTGGGATTGGCATAACGTCGAAGCCGCTGAGTCGAA
GTCAGGTTCGCCAAAGGAGTACGGTGAAGCTGGGCGAGGGTCGGCTCGGGTTGGCTCGTAGCCGCCGCTGAGCTGACAGGAGCCGCAGCCGAGTCTGCCG
ATGAAGTCGCAGAAGTAGCCTGACTAGCTGGAAGAGCCACACTAGGACCAACAGCGGAACTAGCCACTGGAGCGTCTTGGCGAGGATGGACAATCAACTC
TAACCACCGGGTTTCACCAGCCGGAATGTGAAGAACTTCAGAGAAGCGAGACTCCAAGACACGACACAGCCGGGCGTTAAGAAGAAGGTCGGACGGATCA
AGTCCAGGAACCTGCAAGCCACCGCCAGCAGCAGCAGCCATGTGAGGATCGTGCATCGGAATAATACCATTCCGACGGATGAGCCGCTTCTGCCGCAAGA
TCACAGCCCGCTGCTCAGCGATCACCGACTGAGCGTGCCGCAAGGGTTGGGTGCCGGTGGAGCTGTACAGCCGCACCGATTCCTGCAGTTGCTCGAAATG
CTTGGAAGCGATGCCCTGAAGAGTGACGAACGCCGCATCCCTCTCGGAAATAGATCGGAGTAGGACTGCGATCTCGGTGTCTCGATCCAAGACTTGCTGA
TGGTGGAGCTGGGCCTGACTCAACGCAGCGTCAACCTTGCTCTGCTCAGCTGCGATAGCCCGAGCAAGTTTCGCTTTACTCAGGGCTACAGCCTTTCGCA
GTGAAGCAAGGAGATAAGCAGACTGCGTGGCAGCAGCCTCCAATCGGAACACCTTTTGTCGCGCCGATGAGAGCTGAGTGGACAAGTCGACGTTGCTGAG
AGCAAGAGAGTCCAGTCGCCGAGTCAATGGGCGGTTCTTTTCTTAAACAGCTTGATTGTCGGCCCGGAGATCGCCAATGATCTGGGGATAATCAAGAGCG
GCGTAGTTGCCTTTCAAGATATCCAACAGCTCCCCCGCGGAAGAAGCATGCAAGATCCCTCGCCGCTGCGCGGGATCGGAAGGCTCCACGGAACGAGTGA
ATCCGTAGGCCATGAGCCTCGCCAAGAAAGTCAATTCATCTCGACGCTCGTGCCCCTGCTCGTTAACCCTGGCCACGAGGGAGTCAAGACTCACTGG