Description :
From Genome Similarity Track
Location :
Scaffold_33:137527- 140311
Sequence
2784 bases(100 bases per row)
TAATACTTCTAGTGGCAAAAGGATAGATGTGGGCATGTGGGCATCACCAAACGCAAAAAGTGGGTTCAACGCCGACTGTTCATCCAGCCGAGCGACTCTT
ATTTCGGATGGCGACAATGGCAACAGGTCCCTGCGGGGCCACAAGGCAGGCAATGTGAATGACGGTAATGCTGGCGtcggcgaagaagaagaagagagag
agagagaccTATCGGCACtaagaagctgctcaattTGAAGCTATTCGATTTTGACGAAAAGAATCCGAGCAAGATGTTGTATGACGAGAAGTTCAAGCTC
AAAATGTTTGGGAAATGCGATCGGCATGGGTACATCGCGGGGAAGATCGGTGAAAAGCTGAATGCGGATAACGACAGGTTCTACAACAAGTTGTTGTTAG
AGTTTTTGAACAAATATCCACACCGTGGATACCATGCAAAGTCGCCAAAAAAGATCAATGCTATCCAGGATACACAGAACAAAAAAACAATCAAGATTTC
GGAAAGTCTAAACAAAGAATACATATTCGACTGAGGCTGCATCGACACAGTGTAGGCGTGCTCTAGATCCAGAGTACAATCAGGAAAGACTTTGCCAGCG
ATATAATTCTTGTCCAATAAAGTCAGGGTTTAATAAAACCTATTGTTTTATGCTATTATGAACCCTTATTTTGGGATAGTAAATCtaatgctgcagctgg
caCCCCAACTGGTTAATTTCGTGAAAGCATACCCAAAACCGGTACAAGACGATACCAACCGGTACGACCGGAGAATTGCATACCCCCCAAATCTTTTAAG
CACACAACCGGTATGGTTGGTGGCTCTCCAAAATTCTGGGAAACAGTCGCatcgtttttttttaaatcCCGCTGACCATAGTCTGATTATACTGCAATGC
ATGTTGAAATCACTTCATGCTTAGAAGACACTGGCCCATGCACGTCATGATTTTTATGATTCATCTCCACTATCTCAGTCTACACCGAAGCCCTAGTCAT
TGACAGCAAATGTTCGGAAAGATTTTACCCAAGAGAACATAAGAAAGTTGAAGCGTTCAAACTCGAACGGTTTGGGAAGTGTGAACAAACATAAGCGATC
AAGGAAAAGCTGAATTATAGTCTGCGCTACGAAATAAAAACCGCTGAAGAAAAGTGAAGCCTCGTAGAAAAAGAACATAGCACTTTTAAAAAAATTGCCA
TCCTCCTAGAAATTGGTGTACGTCATCAGCGATGACAAGAATCCACGGCGGTTTGAGATTTGCTTCTTTGAAGTGCTACTATATTCGTAGACTTTCTTCG
ACAATTGACCGAAGAAGCTCTGAAATGTTGAGGATTGCTTTGCTGGCAAAAGAGTTTTTATTGTCTTGTATCTTCTCTACTGTTGCAGTTAGTGTCGAAC
GGCACGGCCCCAGAGCGATAGACACAAACATGGATCCAGTATGAGGACTGTTGTCTTCATTGTTTTTGTAAAAAGAAGACGGGTTAATCCTGCAGAGGAG
TCCTCTGACATGGACGAATGTGGCTCCAATTTGGGGGCAACActtagaagaagaagggcatTTGATTGAAGACGACAATAAATTACTTCGAAATACTCGT
TTTTACACTTGAATGCTAACCGTGGCCAAGCAACATCCGTAATTTATTATTTTGAAAAGGGTACAGTATTAAAACCCCAAATCAATTCACTTGAGTTTTG
ACTTGACATTGTGAGAAAATTATTCCAATCACTTAAACGATTTTTGGCACAACTAAATCTTTCCCACCAGTGAATCCGATCGCTTATTAACTCTGAAATA
AATTTCAGAAAACAGTTTACTTCGCAATTCACCGTCCAGAATTCGGGTTAAGTACATCCAAGTCGCCAACTGCAGCCCAATACACGACCATGCGTCTAAG
CTACgtcttggtggtggttgcgGTCACGCTCCTAGCAAATTGCGGTACCGAGTCGACAGTTGGCACGTCGGTGATGTCGACCCCGTCGTGCAACTCTATT
CCGagcaatgacgacgatggtgagGGAACCGTcgacatgaagaagctaTTTGATTTCGATAATAGGACTGCTCAAAATGATGATGGACGAGAAGTTCAAG
TTCAAATGTTCGCGAAATGGGACAAACAGTAGATCGTGGGGGAGGTCAACAAAAAGCTACATCCGAAGTACAATTAGCGCCACCATaagctgttgctgaa
ctATTGAACAAATATCAAAAGATGCTAGCTAAACCAGGTCGAGCCTGCACAGAACAAGAAAATTGCCAAGATTTCGGAAAGCCTAAACAAAGTCCACGTA
TTCGACTCAGGTTCTATCGGCGTTGTAGTGAAGGTGGGGATCCTCAAATGGGAAGACTTTTACCATCTTTCGAATCCTTGTCAAATAAAAATTGCCGACA
GCGATCACGAGGACTGCACAGCCCTTTGAACCTGAGGACTCGCACATTGACTTTTTCGAGCTCCAGATTGTGCGGTAGCATCATCACGCAACGCAGTGGT
ATTGTCCTGAAATTGTGTCATGTCTCGATTGGCGGTGCACTGTGGGGTTTGATGTACGAATAGCTGTTCATGAATTGCGTCCTCTCAAGATCTTTGTAAT
TAAGTtaatgattggatgaaataCACAGTAAATTCAACCACGTGTTTTCATTGGCGGAGAACCATACGCATTTTCTACAGTATGTATCATTGACTGAAAT
ATACTATTAAAATTGCACATCGAGCGCCCACCCATTCATTCTTGCATTGTGTCGTCTCTATCTAATCTATCAACCTTGTACTAA