Description :
From Genome Similarity Track
Location :
contig_50:137511- 160701
Transcript NameFunction/comments
g8440.t1hypothetical protein

Sequence
23190 bases(100 bases per row)
TTTCCAGTACTAGGAAGAGGAATGCTCTGGCCACTGTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCAGTGCTGCTAGGTCGGG
TTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATCATCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGACTCTCCAATTGTACGT
CCCATCACCTTTTGAACCCGGGATGCTATGATCTTCGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCCATCGCGTTGTCCGAGT
CTCCTTTCTTCCTCAAGGGAATGATGAGCCCTTCGAGGAAGGATTTTGGTGGTTCTCCTCCTTTTAGGAGCTCATTGCCGATAGCCACCATAGCTGGCAC
GAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTGTTGAGGCCATCCGGGCCCGCTGCTTTATGCCTGTTCAACGCGTCAAATGCTTCAATGACTTCATCC
GTCGTGATCGGCCTCATGAGGAGCTGGTTTCCTTGCTCAGTGACCTTTCGCTCTGCCGGTATAGTGACAAACGCATCAAATTCTGCCTCCATCGCTTCCG
ACTTGATTTCATTGTGCTCCTTTCCTAATATGGGTTTCCATTCCGATCCGAAGCGGTCAGCGATTGTATCTCTCGTGTGAACTCCTTTCCATTGAGTCTA
CTGATCGTTGAGATGGTCTGATCTCGCTCCCAGTTTGAGACTCGTTTGTAGTTCCAGCGAATTTGTTCCATTGAGCGCTCTAACCACTGCGCTGTTCGCA
CCAGGTCCTCCGCGCTTCCTCCTCCGTGACCGCGATGAGTTGTGATCTGGTCATTGGCTGTCCTCTATTTTGAGCGGCTATCTTGTGCACAGTGTGTTGC
GCCGTTGATAGTCTCTGCGCTTCACGTGTTTGATGCATTGTACGCAGGTTCTTGCTTGATCATCCCAGTTGGCCACCGTGGTGTTCCTTCCGACGCCCGC
CTCCGTTAATTCAGTGAGCAGCTCCTGTTGGACTCGTTCTGGTTGGGCCGTCCTGATCGGGTAGGTTACCTTTTGCCCTTGCCTCCTCCGTTTGCTGCCT
ACCGGTGCTGCGCTCCAGTGCAAGCTGACTCGTTGATGGTCGGTTGGCAGCGCTGGTTCCTCGACTGATACCCATTGTACGTCGCTGACCCAAGATTGAG
GGACGTAGAAGCGGTCTATTCGGCTGGCCGTTTCTGGGCCCCAGAAGGTGTAGAATTCGGTTGGCTCCGGGTCTTCATCCGTGTCTTCCACTGGATCCAC
CATTATTCGGGCATCCTCTAGGTGTCTACCTGTCACGAAGTCCCGTAGCGCTGCTGATTCCGGTCTCCCCGACCTCTGGCCCCCTAGTCGATCTAGTGTT
GGACTCTGGACGCTGTTGAAGTCCCCTGCAAGTACTACGTCGTTATCCGGCCAAGCCCAGTCATTCAGGCTTCTGAAGAATTCCTCGCGGTCTGCGTTCC
CATTTGGCGCGTATACGTTTACCACGAGGGCTTCGTCAATGCGCACCGCGATCACCCGACTTGACCAGTGTTGCTGGAGCGCTGGCCGCGCGGTTTTCGC
CGTGGCTGGTGTTAGCAATACCGCTACTCCTCCTGATCTGCTGTCATTTGTGCTCCAATACGACATCCTGGGGCAGTCTCTCGAGTTTTGTTGCCCCCAT
AGTCTCCTCCAGTCCTCCTCCAGTTTGGCCGCTTCGTCCAGTGATCCCACATGCGTCTCTTGTACTAGCCACGCCAGTGGTCTCTCCCTTACTGGGGTCC
TCCTCCACGCCGCCATCCACCTTCTTCTACTTTCCTCTTTGAAACCCCGCTGTCTAGTCGTCGCTGCCCGACTTTGGCTGCCATTGTCTCCTCTGCGGTT
CCGTCCTCCGCATTCCCCTTAAAAATCGTAAACGTCCGTAAACGTCTACTGCCTCGCCCCCTACTATGCCGTCCGGAGGCGAGACATTGGCCTGCTCCGC
GCAGCCCTTAGTACTGGTGATTTTGAGCTTCCTCTCCTCGTTCTATAGTCGAAGAGAAGAATCGCGCCACTGCAACCAATCTAGGGAGTGTTTAGTCGTT
GCATAAGCCGCCTTGTAGCCTTCATGGGTTCGTAGCGCTTCGAGGTGTCTCGTCAATCTCGCGAGCGCCCCATTATCGTCCTCGTCCTCCGAGCCCGTTA
GGATTCTGATTTCCTGGTCATAGATCACGGCACATAGGAGGTGCTGCGCGAGGCGTAGTTTGTTGCCGATGTCGCATAGTTTGAGAACTTCATCGTTACC
GTATCCACACGCCCGCATCCTGACCCAGTCGTCTCGGTTGTCTATCAGCGGCGGTAGCCGAGATTCCCGCGATGGGAATTTACTTCTCCACGCATCGATC
CACCGATGCACCTCCGGGTCGTTCGTACGGTCTCTTAAGCGCCTAATTGTGCATATAGACACCCCCGTCGCCATCCTGCTGTCCATTCCTCTAGAACTTT
CTCGCTGAGGGAGGTTAGGAGCTCCTCTGGATATGGAAAGCGCTGAACCATGTAGAGCAGCTTGGACGGCTCCTTTTGTGCGGCTTGATCCATTCCTGCG
TCGGGCTTCGATCGAGTGGTAGTGACACTTGCGCTGTTTCCGGCCATTGTTGGCCTAACTTCTGCCATAAATCTGGCCATGCATCTCGGGTCATAAGCGT
CTCCGTTGCTGGCTGCTCGGCGATGTCCTGCATAGAGACTGCGCTGGCAGTGTGCCGCTTCGTTTCCTCCTGGGTCCGCATGATTTGCCGAATTTGTTCT
CCTTCAATCGGAGTGGTTGAGTGATTACGCTTCTGCGTCCTGGCCTCCTTGGTTGCCCTTGTCGCGGGGACTGCGACCTGCTCGGCACAATCGAGCTTTG
GAGCAGTGTCGCCGGATTACGGCCTTCGTTCAAGCTACGATGGCGCCGGAGCATAATCGAACAGTGCTTGGTTGATGACAGAGTTGGTAAGGCGCATGCC
ACGGGCCTATCAAGGTCGCGTGGTGACGGCAGAGACGATGAGGGCGTGTCGTGTACGGTACTATTGGCCTCAATGCACGTGACACGATGCGTCAGTGGGC
GGAGGCACGCGCTCAACTGCATGAAGGCGAGCAGGCCGCAGGTAGGCGAGCAGCTCGCAGATTTTACATGATAGCTTTTCCCATTAATAAACTTTCCTCT
TTGGAAAACAACCCCGGGTATTCGCGACAATGAACCACTGCTCATGACAAGCTAAAAGGCAGGTATTGTCTTCAATATAAACGCTAAATCGCTATTGTTT
TAACCCTTTCGCGGTACAAGGGTGCATTTTTCGCCCTTTAAGGCTATTGACAAAATACGGTGAGAATGTGCCTCCTTAAAGGGCGCATTTTGCGCCCTTT
AAGGTCCCTCTTCGAATTCGGCTATCGTGTATTGTTACTACCAATCAGAGCGCTTGGTACAAAAATAATACGGGTAAATTTGGGCATTAGCGGTTATATT
TCCAGTTGTGTCTGGTAAGTACGAAGTATATTGTGCCACGTCGCCGTCACTTGAACATAAAACGATAAAATGGACGTCTTCGTGCAACGTCGCCATGAAC
ATGTCGCCAAATAGTGGACATAAAATGAAATCAGTGCATATCGCCCCCCCCTTCCGCCCATCTTCCTCCCTCCCTCTTCCAGTCGATTTCTACTATACTA
AAAACAAGTTTCATACACCCTTCTTCTATCTTTGGCCATGCGCACGCTATTCGAGGACTGGGAGGATAAAGCCCTCGTCCAGATTGCATTTCAGTTTGAG
CGCGAAGGAATCCGGATCACATGGACTACGTGGCACGCCGGTTCAAGAAGAAGCGGACTGCGCAACAGCTACGCTTGAGGCTAGCTAGCCTCAAGCGCAC
GTATGGGAGGAGAATCGTAGACTTCCCACCGTGCTTCTTTTCCAGTGTCGCTCGGGGACGACTTTTGCGAGCAGTACCAGAAGTTCGACCTCAACTACCA
GTCTGTCGAACACGAGCAGCAGGGTCATCGCCCGCTTATCCGATGACTGCGAGTCCAGATCAAGCAGCGATTTCCCGTTCTTCATATCTGCACTCCATGC
TGACGCCGACTGAAGCGTCTCAGGTAATGGCTTCCCTTTTTGGGAGCATCAGCGCCGGAGATATACGGCAGCCAGCAGGTCGTGTGCACGACAATGCTGG
AGAGATCCTCCCTCCAGGTGTCTCCACCATCGTTGGCGCTGTAGGTCCCGTTGGTGTCCGTGACGTCTTCCTCGATGTTGGGTCAGGAATAGGCAATGTT
GTCGCCCAAGTCGCGCTCATGACAAGTGCCCGCGTCTGTGTTGGAGTTGAGCTTCGTGCCGAGTTGTGCTCACTTGGTCAAGCGTGTATTGAGCGCTATG
CAGCCTCTCTACCTCAGCTTCGCAAGGTGTATTTGAAGGCCTCAGACGTGAGAGATGCTGCTCTGTCATCACAGGCTCCCACGTGCGAAGCAACCATCAT
CTTTGCGAATATCTTCCTCTTTGAGGAAGATGCTAAGTTAGTCGTCGCGCGTGAGCTCGCTGTGATGCCAAATGCACGAGTAATAGCAGCAACTTCTCGC
TTTTGCCCCAGACACCGTGCTTCCTGCTCGGAGATCTTTTGCACTCACTGGTCGTTAGTGCGTGAAGTAATGGCGTCATGTAGTTGGAAGTCGTCTCTTC
ACCCAATTTATATTTACAATAAAGCCTAAGTTTCAAACTACATACACTTTCTTTAGACAGCGTGGTCGGCAAGGCTCCTAAGTCGATCTTCATCAGCAGG
TCCGCGCCAACGCCGACGCAATCTTCACGAACAGGGCGGCACTGACGCCGTCACGAACTTCATCAGCAGGTCAGCAGGACGGCGCTTCCCCGACATCAAT
TCCAGGAGCTGCACGGCGCCGAAGCCGGCGCGATCTTCATGAGCAGAACAACGCTGATGCCGCCGCCATCTTCACGAGCACGATGGTGTCGACCCTTCCG
TCAAGTTCAGCAGCTGCACGGCACAGACGCCGCCTCGATCTTCATCAGCAGAAGGCGACCACACCGACGCCAAGTCACGAGCTGTGCGGTGACCACGCCA
ACGTCAAGTACACGAGCAATTACACTTACAGATGGATTTGACGAGTTGCACCTGGCTTCGCTGTTGGTGAGGTCTCAATTTGGGAGGCATCTTGTCGAAG
TTTGGTAAGCTGAGAGTGTCGCCGGATATTGCCCTTGTCTGTAAACAAGCTTTGAGGCTCGTAGAACTGGTGAAATTTTTCCCAGCACGTCAATTCAATC
TGCGGGCACATCCACGGCTTCGCGGCTTGAACGTGCACCACTCGACATAGGCACACACTGTGTGTCACGCAGTAGTTAGTTACCTCGGTCGGGTACCGGC
CCTCCCATCGACAAACAATGCAGCTTCGGCGTTTCCTGTTCCTCTCCGCGTATATTTGTTTGGAGGCCACGGAGGCGCACCCACTCACTGCCAGCCTATT
GCCTGACTCAGTTTGCATGACTGGGCATGCGTGGGCTGATGCATCTTCCTCTTCTTCAGCATTACGACTTGTGTACAGCATACGACCTTCGCTAGGCGCT
TCAGCCCACTGACCGTTGATGAGCTCGGCCACCAATTCAGTGACGAACGCTCGATGGGGATCTCGTGCAGTAGAATCGGGCTTTGCCAGCCGTCGTGTCA
AGTAAGCATTCGATCTTGCAACATCTATGAGCGCTAAGGCAAGTTTCTTATGCCAGCGCTTGTAGGAGTGCCCGTCCGCAATAGAGAATCGTCCTCGAAT
TTGATCGAGTCTATCCACCCCTTGCATATTCCTGTTGTATCGAGCAACGCAAACAGGAGCCGAGAAAGCTCGCCTCTCATTTCCTATCATACGGTTTACG
GTAGTGGTAGTTGACGCGTCAGCATTCGACACCATATTCACCACATTTCCGTCACACCACGAGGCTGCAAGCATGCTATGATCAGAGGAGACAGCCTGCC
GGTGATCACCGCGCACGCAATCGTCTTTGTGGAGGATAGTGTGGCTGGGGAAGTGTTTGCTGTTTGCTCGTATCGTTCCTCTGGCGTAAAGACCCTTTAG
GCGAAGCTCTTGGAGCAGCTGAACACTGGTGTAGTAGTTGTCCATATTAAGAACCCTGTTGGACCCAAAAAATGGTCGTGCCACCTCCAGAACGTGTTGT
CGAATCTTCGACACTTTCTCTAGCTCCTCACGTAGATCCTGTGCCTCCACTTGGCCTATAACACCATGCAAGCGATCGGAGATGTCGCTCTGGTTGCAAT
GAAGTCTGTAGTTCAATGAAATCCAGGTGCTCGAACAGCAGATCATGTACAGTCGGAAATGGTACTTCCCTGTTGGCTTTAAGGGATTGTACACGATGAG
GTGGCGTCCTTGACGAGAGCGACAAGCTACGCTTGCCTCATCCAGGGCGACATCCCTACCGACGTTGACGTATTGCCCACCGGTTTTTCAGCAGGTTGAG
CAGGGGCCGGATACGTGCAGCAGCATCCTTCTCGAGTGTCGTCGGAGTTGCATTGAAGCTCAGGCATCTTCTAAGCAACTTGAAGCGGTTTAGAGTCATC
ACAATGTCTAGTGAAGTTGTAGCCCCACCAAAAATAAGGTCTTCCGGCTGGGGACCCCAGTAGTTGGCGTACTCCCCTTTTTCGTTGACTGCCATGAAGA
ACATAATCCCGAGGAACGCCATCAGCTCCGACAGTGTGAACGGCGTAGACGTTTTCACTTCTTTTAGAGCGGCGTAACGGTTCGTCTCGTGGAGGACTTG
GCGCCAAAAATACAGCGGAAGGTACGCGAAGAAACTGGAGCTCGCAGAGTGATCGAAGAGGTGCTTGTATTCCGGACGCAAGTAGGTCTTCGTAGTCCCA
TCGGCATGCTCATATAAATATGAAGGTGCCTCAACGTGCGCTGACGGCTCAAACCGCATGCTCCGAATTGCCTCAACCTCGTCCAGGCTGGTTGGAAGAA
GCTCCGATGCATCAAAAGCCTCGTAGAGATCATCTGCTGCTACGAGGTCAGACTCGGCATCACCGACTTCAATAGCTTCGGAAGAATCAGGCTCCGTCAA
CACATGCCAGTCGGGATTCTTGATTCGCGTGAGGGCAACGTAGTTCTTGATGCCCAGTTGGACAGCACCCACACTGAGATGCTCCACGGCGCTCTGGAAT
TGGCTGTCCAGCCAACGTACTTGAAACAATGAAGCAAATTTGCCTTTCTTGACTTGACGACACACCCTTCCAACGATGTACGCAGTGCCAATAGGTCTGT
AGACCTTAGCCTTCATCCACACCGACTTTTCAGGTGAAAAGGCCACCAGTCTATCGACGTAAACATCTTGCAGCAAGACAGGTGGTGTCCGGGCTGGAGT
CACATCACTCGGAGACACGACATTTCGTTGTGGAACGCGAGTCGGTGTCGTGCTTACGGTAGCTTCGAGTTGACCATCGCCGCGACCCCCACCATTCGCT
TGGGCGTCATCGTCGCCAGCCGCACTTCTACCTCGGTTATCACGCCCACCACGACATGGTTGGACGTCACTTCCGCCAGCCGCGCGTCCACCTCGGCTAC
CACGCCCACCACGACGTGCTTGGACGTCACTTCCACCGGCCGCGCGCCCACCTCGCCTACCACGCCCACCACGACGTGCTTGAACGTCACGACCGCCAGC
CGCGCGTACACCACGACTGTCACAATCACCACCACCACGTGCTTGAACGTCACTGTCACCAGCCGCGCGTCCGCCTCCACCGACCGCTCGAGCACCTCCG
TTTCCACTCGCAGCACCACCTGCACAACGTAAGCAGTCTCAACATTAGCAATATTAGCAGCAATATCACCTCACCGTTTCAACTTACCACTCGTGATCAC
TGTGACGTCTGTAGGTCCGGTATGTGCGGGTAGCTCCATTGGCAGGACGCCGGTTGCAGCGCTGACGAACTGGAGTACGGCAAATTCGCCAAGGAGAAAG
TCGACACCTTCCTGTCCTTTTGGGTCCCCGCCTGGCCGAACATACCGGTACCGGGAATCTAGGCTTTTGCTGGACGGCGGCTTTGCAGACCAACCCTTCT
TGCGTAGCTGCACCCACGCGTCCTTAAACACAGCGACGCCACCAAGACTAGTCGCTGTGTCAGCAGCAACGGACCCACCTTGTGACGACCCCGTGAGCCG
TTGACGCTTGCGCGCTCCTAGCTTCTGAACCTCATTTCGCCTTCTGCCAACCATTTGCTCATTCCGAAAGTGAGGGCGAAATAGAAGGCTGCTGTACGTC
GTAACATCGTAAACTTATAAAGGTTTTCAAGTAATTAAAATATATTGAGTTTTGATTTGATAAGTACCATCATACACCGGGTATAATATTTTACAAGGAT
TTTTCGCGCCGAATTTTTCGCGCGCGGCCAGATGCCGACATGCTGATTTACATATATCAATACAAATTGCAAGATAAATGCAGGTCGAAGCTCAGATAAT
ACAAACTACAAGGTAGATACACATCTCGACCGAATCATACAAACTACAAGGTATATACATATCTTGGCCGCATGCTGGTTGCCAATCAGTCGTGCAGCGC
GTATTGAAGGCTCTGAATGATTGATATGGCAGCCCCACACGAACCAAATCCTCAAGAGCAATCGGAGGCGGGCTTTGAGGTCGCTCCGACACCAACACTT
TCCTCCGCAGAACGGCGGTGCTCGATCAGTACTGCCATATCAAAGCGACCATTTCAGCATACTGCTGGCCGTGCTCGCGCGTCCTCCTGATTCGGAGGCG
CGTCATCGTTCATAGACGAGGATTCCATATAATAAATGACGGGTAAATTACTGGATAGGTACAATGTACCGATTATTATTGCCCAATCAGCGGTGTATAG
GCTACCCGCAACCGAAAAGCTCCTATATTGGCCAATCAGAGGCATTGCTAAAAGGGCGCATTTTGCGCCCTTTTAGGACAGTATTGGCTGCCTCAGATTG
CATCCCCTGTGATTTGTTTGCACGTCCTGTCTATATTAGGAACTAAAAGGGCGCATTTTGCGCCCTTTTAGTTTGGAGTTACTTAACTTTCTATACTATA
GTTTATCCCTGCGACTCGCGAAAGGGTTAATTACTAAAATATAATCAAAGAACACAAACTCCATATCCTCCATCATCAAGGTGGAGTTTGTATTCTATGA
TGATTGTAGTTGACGGGAAATCAAAAGTTGCCATCGCCAACAAACCATAGCAAGTTTACCTGATGGTCTCACGAGTAACTTCATGAAATGCGTTCTTGAC
GTTAAATCCATTTACCAATGAGTCGACTGCGTGAGCCGAGCCTCCCGTTCCTGCACTAACCGAAGAGCGCCGCCTGCTAATTGGAGATTGACATGTGACC
AAAAGTTAAGCTTGTATCTCTCGCTCGCATAAATTAATGAATGTTGCCGGATGACAAACTGCCTTCGAGCCGCAAATGGCAGTTCGTACGAATTGCGAAT
TTCGACATTGACAAAATATGTGTACTACGAGATGTAGATGCGGAGAAGATGCGTGATGCTGCGGAGAGAGTAAGGAAAATTGCCAAGCAGATTCAGTTTT
GGCACGAGAGTGGAGAAAACCCTGGCGACTTCTGTATGCTGCAATTCTAGGTAGCTATCTTCGTCCATCGCCGCGCCCGCATTTCCGCTATGAAGCAAAA
ATGCGTAGGTTGAACTACGTTTGTTTTTGAATGGTGCTTTGAACCAGTTGTGAAGACTGTAATATCGCGCCGATTCTCCTCGTCTGAATTTCGTCACTGT
TGACAACTCTCCATCGGCGACATTACTTTCGTTGAGTTGAGTTGAATTAGAATCAGTCCCATCGGTCTATCAACTTCGGAGTTTGTTTTTTGATAAACAA
AAACTTTCAGTTTAGATTTACGATTGGATAGCTAACTCTCGAGTTGCAGTATTTTGTAGTGCATGGGCATTCCGTGAGATTTTTTTGCGTCGGCGATTAG
TTGAGATTGACCTCGTCGCTATCAATATCTAAATCGACGAGACTGTCATTTCAAGCATCTTAGAGCTCAAATCTTGAGCCAAGTGATTAACTGCAGGTTG
CATGTTTCCTGCATTATTAAAGCTGTGGCCTCACGAACAGCAGATTTTCTTCCGTTAAGCCAGTGCTGAAGATTTTTGTATTTTCCTCTCTCCTTCCAGG
GCGTAGTCAACGTTCTACGATCCCGCAGCCGAACACCTGGACAAATTTGTGAGCCTATAAGAAGCCTCATGATGAGACATATTCCGGTTACTATCATTTA
AACACAAATAGAGGACCTCTTAACCCCCTCCCTCCGGTTACTATCATCTATAACTGAGATGCTTCAAGAAGCGAAGAGAGCAGGTCGCCACCAATCTACA
AACGGAACAGCTTCCGTATTGCTGGGCATACAGATACCTCGCCCACGGACTTTCAGCGATTCAGGTTTCACAAAACTGGAAATCGTCTTTCTATCCTGCA
GAGCACGAGCGATTTCCGCGTGAAATTGACTGTCAAACAATACTACGAAAAACCTGATTGCAGTGTTTCCCGGGTAGAAGTACCAACTTGTAAACACACG
GCGATGCGGGAGCCACTCCGCACGGAACTAAGCCGAGTGTATTGATGGGTTGATAGCTAGATGGAAAGTTGAAGTGAGGTCCGGGTCTGATGGTAACCAG
CACGTCACGCACGCTCTGCTTCTGGCCCACAGGCATCCCCAAGGCTGACGAAGAGAGAGATGGAATGTAGTGGACAGAATCCGAAAGGCAACATGCACAT
CGACATGCTAAGCTCCTGATGTAGGCCAGGCCAGGCACTGGCAGCCAGACCGGTAGATAATATGGCGCCCCACCGCCTGAGGCTGGCGACTGTCTGATGC
ATCTGGGTTATCTGTGATCACGTCTACGCTGGGGTAGCTCCGTCCGTAGGCATGGTGATACCAAGATGAAATATCTGGCATCTACTACACCGATACTGAT
AGTGCTTTATCAAGGATAGATGGCCAGAGAAATAGCCCCTAACGTTAGTACGGAAATGTCCGCTAAACGCTGTTTATTAAAGGTTGGATGGTCCACCTAT
CTCCGGAGTTCGTCTCCAGAGACCTACAACTAGACCTATAAACGGCAATTAGGGGCGGGACAGCACGTATGACAACAGCGTAGGAAATATGATAATCAAT
TTTTCGCTGATGCTAAATGAGAGATGATCAAGCCTATTCTTTAGCTCCTGAGTCAGGCGCATTAACCTATTCAATGAGCGTCTCCCCACGAAGATAGCAA
TGATTGAGACGTTCTCGAAGAGCAACGGTAATGTTGCTGGAGGCGGCGAAGGAGGTCCCGCCTACAGAGCATGCACTTTGTTGGAAGGGGGTTACTTTTT
CAAGAACATGTTGAATCTGGATCCGGCGACAGGACGCGAGAATTCGTACCCAATTAAATTGTTCTCTTTTAAAAGCCTGAATAGTTTACCGATGGTTTCG
TACCTGATAGCTCACTCAATGAAAACGAATTTTCAATATCAAGGTTGTGGCCTTGAAGATAGTTGAGCGCGGATATACGAACTCTGATATCATTTCGTCG
AAGCACGCGCATGTTGACTCCTACAGGCCTTCAGTTTCTCTTACTGGTTTAGAGCAGAATGTTCCGGGGAGGCTTGTCAGGTTTGATATTCTTCAAGCGC
AATGAAAGGTTGACAAGAGCTCCCGCCATTTGAAAAGTATCAATCTGAATCTACGTCACAATTTGTCAAAGTGGTTTACTCGTCTCGCGAACGTACGATG
CGGCCAAAAGTTTACAGATTTCCGGCCAAAAGTTTACAGATTTTCGAGTTCGATTTTCTAGGTTGTTGTATCACCTTATGCTGAAGAAATGACAAATGTA
GTTGCGGGAGGGCGATGACAATTGAAGAACAGTATTGAAATGAAGTTCCGTAGGATATTTAGGGAGTATGATAGCTGAATAGACCTCAGCAGATAAGGTA
AGAAATTACCTCCCACACGTCGAAATCGCTTGAATAGACGCAACTTGTCTAGTGGTAATCATAATCTAAGATGTGGCCGGCAGCATCAAAGCTGCAGTTG
CCTCTGGTTAAACTAAGGGCCCCACTCTCCGACCCAACTGGCACGCACGTGTTCTCAACGTGAAGTTCACATACAGTACGGAATTATTTTGCGCCACGCA
ATCACCGTGGGGAAATGACGACCGTCCTTTGATGAAATCAGGACTCCCGATTATGGCATGGTCTTTTACATAATTTCTTATGAAATCATAAATATATTTA
TTTTCTGGCAGACTTGAAGACCATAACATTATTTATTGTGGAGGCACCGATGCATAATTTATAAAGCTCGGCCTTCATTCTAATGAAGTCGTTCAAGCCG
TCAAATCATGGTGTCATTAGAACTTCTAAGCAAAGTAGGTTTTTATTCTCGCACAGACCTCTCCAAAGTAAGAATTTCATGTTTTTGAGGGTGCAATGCA
CACTCCACTAACGTGCCATTATTTGCTGTTCGCAGCAGCAAGATGACATAACTTATGTCTCGACTCTCATAAATAAAAATTCCATCATCGGGAGCCCTGA
TTGAAAGCTTCAGCAAAACGCGATCGCAGGGTCCCACAAGTTTTGTCGAGCTGCAGCCAGATCCAATACAGTAGCCCCCACGAACTGAATGACATGCGTG
GCTTGAACACATTGACGGTCACAAATGCATTGCGCCAAAACTTGAAATTCCCAATCGATGTTGGACGGAATTTGAGGGACGATGAGGGATTTGTGTTATT
TAACCTCGGTGAGTTGTGATAACATAATAGACGACACGACTGTGAACGACGAGCACGATGGGGACGGCGGAGCTCGTTCATATAACTGAGTCGACTCGCA
CGTCGTACTCGGGCTGCTCGATTAGACGTGCTCAACGCGATGGCATCTTAAATCGCGTCGAATTCCGCGCAGGCGCCCTTAATGCATACACGCCAAAGCA
GCAACCTATTTACCATATACCACGTAGAGCTACACGTACAGTAGTAGCAAAATCCCACGCCGTATTCGGGCAGTTCGTGGCAGATGCTGGCGAAGACGAC
GAGGGCGGTCGACAGGTCCCCTGTAACAGTCTTGCGCCGAGGAAGGTCTTGCTTGGCGTGTCCCGTGCGGTCCTTGGGTAGGCAGGTGACGAGGTTGGTG
GAGGGGTTGTTGCTATTGAAAGCAAATTGAGAAGTGATTGAGATTGAGCTGTTTGCTTTTACGGATGTCCTTGAGACCACTAGTGTCCTACCCTAAAGCC
TATCCTTCTCTAATCTCAGCTGCTATCTGTTCTACCAATGATCTTGTCTAAAATATCCACGTAGTTGTAGTTTCATCAAAAATCCAGTTCCCATACTGGA
TATTATCAAATCTTGATGATTTAGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTCTTATCCTTGAATATCTTGCGCCATTCAGATATT
GGTAGACATGCATACGAAAATTTATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCTGACGGCAACTGCGTCACATGACCTCCCTTCAAG
AAGACGCCTATTTTGAAAATGGCTTCGGTCGCTTCTTGGATTTCCAATAGAGGTCGATGAGCCCAGGAATCTGCTTTAGATTCTCAATGGGTTCCCAGGT
TGCATCAGCTCTGAATTCACCTAGCCACCAAATCTTGTACTGCGGTTTTCCCTTGTACATGCGGTGATCAATCACCGCTTCAACGAGTTGTCCTTCGGTT
CCATCGGCTAACACGACTTTGTTCACCTGCTGCCTTCGCTTTGGGTCCTTGCGATACGGTTTCAGCAATGATGTGTGGAACACAGGATGCAACTTTAATC
CCTTCGATAATCCCAACTCATAGGAATCTTTTGAGATCTTCTTTATCACTGGAAAAGGTCCAATGTATCGTGGAGCGAGTTTCTTCGACTGGGCATACCC
CTTGTGACGGATATCCAAATTCTTTCCGTCTAAAAGCACCATGTCGTTGACTTCGAAGTTCTGGACAAGTCTATTCTTGTCGTAATAATACTTCATACGC
TCCTGCGCCTCGCTCATACGGTCTTGTGCGACCTTGAGTAGAGTCTCTTGCTGAAGTAAAAACTCTTGCGCTGTTTTCTCCAATTTCTTAAACTCCGGAT
CTGATGCCACATCGTCTGGCATGTAGGGGACATATCCTAGATCCGCTTCGAACGGCGACATTCGAATCGTGGAGTGTACACGTCGGTTGTAGGCAATTTC
TGCCAAATGGAGATATTCATCCCAGTCATTTTGAGCTGGGTTGACGACACCTCGAAGATAATCTCCGATAAATCGATTTGTCCGTTCCGTTTGTCCATCT
GTTTGGGGTCGGAAAGCCGATGACAAGTTGTGCTGCGTACCAAGCGCACTCACAATACTCTGCCAAAGTTTGGACGTAAACTTGGTGTCTCGATCGGATA
TAATGGTTTTGGGTAAACCGTGATCCTTTACATAATTCTTCATGAACACGTTAGCGATATCTGTGGTGTTGTCCGTTGTCTTCGTCGCAACGAACTTCGC
TCGCTTTGTCAGCCGGTCAACGATTACCATAATCGCATCGCAACCTTTGGTGCTGACAGGCAGTGACACTACAAAATCCATTGAGATGTCTGTCCACCTA
CCCGAAGGTATGTCTAGTGGTTGAAGTAGTCCCGGCGGCTTGGTTTGTCTCGCCTTGTTGCGCTGACACATTTCACATGTGTTGACATAGCGCTGGATGT
ACTTCATCATCTTCGGCCAGTAGTATTTCTCGCGTACTGCCAAATAGGTCTTATAAAACCCTGGGTGTCCTGCTGCTACTGCATCGTGATTCTCGCAAAT
GACTCGATTCTTCAGATCTTCGTCATCAGGGATGTACAATCGTGGAGTCTGGTCTTCCGCAGTTTGATAGAAAAGAATGTCATCCTGTAAGGAGTATTTA
GGCAATTCATCCCCTTGCTTCAGCTTCTTGATGATCCACTGTAGATCCTTGTTCCACGAATACATCGACTTCGCCGTTTGGGCCACTGTCACCTTGTTTG
GTACAATCGTTGCCACAATTTCACGATTCTTGGCTGCTTCCAGTAGCTCTTGTAAGCTTACTTGAGCAGCTTTCAGTTCAAACTCTGGATTTCGTGACAA
TGCATCAGCCACGGTATTCGTTTCTCCGGGAATCCACTTGAACAAAGGCTGGAATTCAGCAAGCTCATTGAACCATCGTGCAACGCGTCGGTTTGTAGTC
TTCTGAGTCAGAATCATCTCAATACTTTTGTGATCCGTTTCGACCGTAAACGGTCGGTCAAGAAGATACACACGCCATACTCGAAGAGCATGCATGATCG
CGAGCAACTCCTGTTCTCGAACAGGGTAGTTTAGTTCTGCTGGCTTCATCTTCCGGCCAGTATACGCGATTGGATGCTCTAGCCCTCCCTCCTTTTGAAA
CAAGACTCCCCCGATTGCAAAATTCGAGGCGTCCATGCGAATACCAAAGGTTTTGTGAAGTCAGGAAGGCCGAGAACTGGTGGTGAGGCTAACCGGCGTT
TAAGCTCTTTGAAGCACTTGAGTTGATCGTCCGAGAGTTCAATAGTCTCTCGTGGACGCTTTCCCTTGATGCTGTCATGAAGTGGTCCTGCAAATTGTGC
AAAGTCCTTACAGATGTAACATTCACAACATGGATCAAGTACACTGTACATTAAAAAATGTTTGTACGACCGGATGCCTGAAGACCTTCCATTCACTAGC
CAACTTTGAATCTGCTCAGGCTGTAACTTGGTTGCAATCTTTTCGGTCGTGGGGGCCCAATCAGCATCTGGGACAGAGCTTCGTCGCCCTAGTTTTAAAC
CGTCAAGGTCGGGATCACCGAAACACTTTCCGTATCCTTCACATTGAATTCGTCCATGTACTTGACTTACCTCATGAACTCCGGGTTATCCAACAGCTTG
TCCTCCGCATTGGTTAGCTTCAACCTCGCAAACGCACTTTTCGGAGGTCTTCCCTTCTTGACTTCTTGACCCAACGTCTTCTCAGTGACTGGCGCTGATG
AACAAGGTTTCAGTTTCTCCAAATTTGAGACAGAAATACCTGTCCTCTGTAGTCTATGGCTGGCCATTTCGACACCTTATCCATATACTTCAAGTACCAA
GCTTCAATATATTCATATTATAATAGGGTAGGTTCATGAGAGAGAAAGCGCACAGGCTTTACAAGCAACGTACTACGGTCTTTCGCAACTGCGTGGACGA
GTTAGATCGTGATCCCTCTCAGATGGTACGCGTTGTAGTCCTCCACGTACTTTTCCAACGTTTCCAGTTCGCATCCGTCTTTTCTTTCACGTGGAAACAG
TGTGGCAACAGCGGCCGGGTCCTTTTCTGCGAAGATGAACTACGTGAGCACCTCAGTCTCCAACTTGTTTGCCAGATCCTTCGTTTTCGGGTTCTTTTGT
GCCGCTGTAATGCCTTTACCAAATCTTCGTCCTTGTAGATAGTCGCCAATACGGTCCGAGGAACAATCTGACCAGGGAAAGACTTGTGGAAATCATCCAT
GAACTTCATCCAATATGCGAACATCGGGCTTTCGAACAGCTTTGAGGGCTTTATCCGATCTAGTTTGAGTAACTTGAAGGCGTCACCCGGTGACTGCGAC
CTCCAACGTGGTGGCCACTCCCCTCGTCCCCGCGACCTTCTTCGCAGCGTCGAGAATCTTCGCGACCGCTTCGTCACCGTAGTAAGTCGTAAGTTTAGCG
ATCGCTGACGTTGTCTTGCCAGGATTCTTGGCGGTAAAATCGTCCACGTACGTAAGCCACGTCGTGAACGGCGGGTTGTCTAGTAGTTTATCTCCAGCCC
TCGTAAGTTTCAGGCGAATAAAGACGTTGTCGATGGACTTCCCGTTTTTCAGCCAGGTCTGGAGTTTCTTCGTGGTGGCAGTCGAAACCAACGCTTTGGC
CTTTTCAATAACGAAGCTTGGAGGTTCACTCTCTCTTCACCGTCGTCGTCTCCGTGAGCGATGAAACCCAACGGTAGCGAGCTGATCGTGATTCGCGATG
TGTAAACGGGCCTGAGTCAGGGAGTCCGGTTGAATAATCTCCGATTTCTTGTGGCGGTGGCCGTATCGGTACTGGCCAGGAGTGCGACAGCTAGCAGCCC
AACGCAGCTCAGACGCATCGTTCTCTTTGAGAGTACCGGTACTCGGAGAATGTTGAGTAGTAATTAGGAGAGCTGTTCACGGACAACTAATTTGTGGAGC
AAGAGCCTCATGCCAAGAGGATGACCACGTAATACTCCAGTACGGGTGTTTACCACACAGCCTACATAACAGAGGGATTTCCGATGTTTTTTACCCAGCC
GATCCGAAATGTGTATCTCTGAGGAGAGACTGTCGTCACGACAGTGTGGTCACCAGTCTCTATTGGCATATCTTCAGGTAATGATGTACATGTAGGTATT
GTATCGTACCAAGGAGTACATGCACTCATGCAAAGTGCACAGTACATCTTGCTGCAGTTTTGGGTTTGCACTCGGTAAATTGCAACGCAGTTGTATAAAT
TCGACTCGGACTGCGTTGTACTTACGTTATTTGAGAAACAGAACTTTGGAGCAACTCGCAAACGTCTTACCTGAATTTATCAGGAGTTTGCACCAATGGC
CAGGATGGCGCAAGAAACATCACCTTACGCAGTCGTTGTTGCCCAGTAACTTGTTGTTGATACCCTCGAGTCGGCACCAACCTATCGGCGTGGGACTATA
GTCATTGGTTTGCCTCCATTGGCGTTAGGTCCGGCCAGGCCCATATCCTCGAGGAACTTGTCCATCCGTGCGGACTCCTTCGCCTAGAATTAATTGCAAC
ACACAATAAGAAAAGACTGAGCAACTCACACCACCAAACCCGTCATTTGGAAACGCTGTACCTTCAGACCCGCGAGCTTCTCTTCCTGCATCTCCTGTTT
GCGGCGTCTCGTCGAGTCACGCTGAGCCATCCGGCGCTTGAACTCCTCGTCGCCATCTCCTCGACCCCGCCCATCAGAAAGTCTTCGCTCACATCGAGGC
CATCCCGTGCATCATCCCGATCTCTTGCCGCACCATGGAGCTTTTGGCTCAGTTGTCGTCGCTTCTCAATCTGAGCCTCTCGTCCTGTAGCTTTGGGTGC
CAGTTCGTCCATGACCGTATCGCGATATTCTCGTTCTCTTTTCTGGTCCAGCTTGCGACGTCTCCACTGCTCCTCCTTGTCTTCTTCGAGTTCCTTGGCT
CTGCGTTTGCTCTTGCTGCTGTCCCTGTTCTCCTCCACTGTGGGCCCTTCACACTCTCCCGCTTACCCCCCGAACTCAGCAGATTTTCTCTTTGTGGCCA
CATCCACCGAGTCTTTAGCCGTCGCCAGCTCGAATTTCTCCTTTTCTCCCAGTTTGGCGACGAACCCCCAGCGATGACGCGTCCGCTTGGTCTGCTCCAC
CACCGCGTCCGGCAAACCTTCGTAAAACATGGTGGACAACTTGCCCCGGTTCCATTTCTTGGCAAACTGGTCCGTAAACAACTCGGTCGCCTCGTCCGTC
GACAAATCATCGACATATTTGCCCCTGATAGAAACAGGAGATCATAACATATCAAGAAGAAAATAAGACCAGATAGTCTCTTTATCTAAAAGAAATAGCA
ACGCACTTTGTCTGTGCGAGCCACACTCGGAACTCCGTCTGTCGCAGAAAATAGTCCTCTTCCGAGATTTTGTTTGTGCCTTTGGGCAGTTTTGTGTCTT
CATGGCGACTGGTTTTGTGACTTTTTGTGGCGCTCATCCTCGGACCGGCGGCTGGCCTTGCGACTGGAGGAGGACGAGAGCTTCTTCGAGTGCGTGTGCG
GCTTGCGGCCCCTGTCGCCTGTAAAGAAGACGAAGACGTTAGAAGAGCCCTGCAGGAGAGGAGAAGAGAGCGAACGCACGATGATCTCGCCCCATTTTGA
TACATGCAGGTAAAAAAAATTTGTTTTTGGCCAATCGCATGTTGTATATCCTACAAACGTATCTAGAAAAGCAGTTACTGTACGTTGTGATCGTTGACGA
CATCGCGTTTCGATGTCGTGGGCTGCAAACAGCGAACCAGAGCATCGGAGCGATCGTGGTGGATACTGCATCACCTGTTTGGAGAACCACACACTACAAA
ACGCGGTTGCAGCAGTACTCGATTCCCACCGATTGGCAAATATACGAAAGAGGTGCTCCGCCACGACAGCGTACCTGTCAGGTGGGTGAGTTCAAAGGAA
ACCCGGCAGAACTTTCCAAAATGCTCAGTGGTGTGGATACCGCTGATGAAATGATCCAGCGATACATCAAGATAGCCAACTTAGTGTAGGGAACATCACG
CAAGTCCGCTTTGGATGATGATGCAGCTAATATTTGGTCATGATGATACCGGTAAGTGGCCTTCTATTTGATGTGTATGTTTCCTATCAATGTAGTAATA
ACATAATTGATCTCGCTCGTCTGTCTTGGAGGGGTTGTATCCAGTTGATCTTGTAGCGTGAAGGTGGAAAGGTATTCCTGCATCGGTCCGGGGTTGCGTT
GGGTTGTTGTAGGTGGAAGTGTCGAGTCTTGTGTGTGTGTTTGCCAGTGTTTAAACTGCTTCCAGGTCCGCTTTTGCTGGTGTGCTCCATTACACGACGA
AGAATCGCTGTAGCACATGACTTAGTTCCTGGGCGGGGCTGTCGCTCACGGTTGTCTCTGGTTTTGCACTGAGGGCTCTGATTGTTTTATCCACACTGAT
GCAGGTAATATTTCGACGCTAACCTCAATAGTTTTGTAGTGTCACTGCAATGGACATGGGAACTGCTCTTTGCTTTGACAGGTTGACAGGCAGTAGCGTA
CTCCGCAGGTTGTGCACTTTTTATTAATAACTCATTGTGGTGGTAGCAAACGCTTGCCAAGGGTCTTGCGAGCGCAGGCACAGCGTGAAAGTGAGCTCCG
TTGTCTATGCTTATGATCCTGCTTCCCTGGCCTTTGCATTACTACATGTACTGTACTGTACAGACGTTCCTCTAGGTCGTGTAGGTTGTAATGTAAGCAG
CTGGAATATCATCCATCGAAGGTGCTTAATTAACTATGGAAATTATCCGTTCGTCCAATGACGCCCCCAAAACGCACCATCGGCCTCTGCTGCTTGCGGC
CAATGGTCTCAGGGGAAAGCCAGTTCTTGAAGTCTTGTCTCTAGTCACTTGTCCGTCATCATGATGACGGTGCTCACTCATGAATGTGTTACCTGTATTT
CAGGATATGGGCTCAAACTTAATAAAGAAAACATAACATAAAACTCGTTGAGACAGAGCATATTATCCGGTTCTACTCGAAATTTCCGCGCGTGGCTGAT
TCAATCGACCCTGACAAAGTGCTTGACATACTGGTGGACACGGTGCCGCTGCGCGGGACCTCTACATGTGCCTGCCGGTTATACACAAAGCGCCCGTCAT
AAAATCCCTTCATCTTACTATGCAGTAGGCATACCAAGTACGGGCTCGACTTGGTAGAAAGCCACACAGTTTGATATCGGTCGATTCCCAAATGGCTTGG
AAACTATCGTCCTGAATCGGAAGGGTCTCTCGATTCGCTGCATAAGCTGGTCCTTTCATCACCGCTGTGCTACAGTGCTACGTTATGCGCACCTCGGTGT
TCCGATACCGCGTCATATCTGTTTATCGCTGCTGGTGGTTATCGCCCACTATTGTGGCCGACTGCCCGTAGCGCTGCCAGCGAGGACCGGGGGACGCAAG
TCTGGATCGGAAGATAAGCTGGGCGTTATGTTAGCACAAGGATGGCGACTAGGACGGACATAGGAAGTCGTTAGCGTAGCTAAATGAACCCATGTACCTT
CACTGAAAAACGAACACTAAAACTTATTGCCCACTACAAAATAATGCTATAACAATACTCAGCAAACCAGTAAGAAGGCTAGGACAAGGTGAATAACATG
TGCAAAGCTGCTATTTCTTATTTTTTTTCGTTTTTCAGTGGCGTACATTGATGTCACTTAGCTGCGCTAACGACTCCCTATGCCGCCCTAGCTACCGTCC
TTATGCCAATAAGTACCCCATGCATTGCATTAGGTAGTTACACTCCGATCTGCATGTACCATGATCACTCGAACACTACCAATACGATTGTCAACACACA
CACACACACGATCTCCGCTCTGCTTGTGGTCGATCCTGCAATTGCTACTGCAAATGCTGTTATACGTTTTAAGAGGTTACCCTGTCCACGAAGCCGTGTA
GCAATGCACTGGTCCGGATGGTATGGTATGCTGGGAAACAGATGCTCAACCTTTCTGGGAAGAATTTACAGCTGCTCCTTGACCTTTCCAGCTCGAATGG
TAATTTCATTCACAAACTTGCCCTCTAGCGCTCCAGTCGGAGGATGCACCGCTGTTTGCTTATTACGTTGACTATATCGTCCGTGCTTCTAAGCCTCGAT
GCCAGTGCAGCGGCGCAACATTCTGAACCAAGCCTCGCCATTGTTTCCAGCTCGCATCGTCTCGTAGTTCCAGACAAGATCGATATTGTCCCCGCGGTGA
GATTCTTGAGAGCTGGCCATACGGCGCCTGATGAAGGCGAAGAGAGAGCGGGGCTCTCCGTGTCCATGGCCGAGAAGGCTAAAACGTTTCTCTCCTCGTC
GACAATCTCCACCGAAAAGCTCCAGAAATGGCTCAGCAGCGGCAAAAATGCAGACACGTTTTCTCGCGCATGAAGCTTACCAAGGCTGGGGATGACCTGC
TTTCTAACCCACAGTTCTCCGTGTGGATCAAGTACGTGGATGATTTGAGCGCCAAGTACCCAGCCAAAGCGACGTCGGCGATCTCGACGCTGACGACTCA
ATACGGCGATGATGCACTGTATAAATTGCTGAAGCTGCAAAGAGTCCCAAGGACAAGAAAATCTCGCCACCAGGCTGCAAGCCGAGCAGATGCAGCACTG
GGCTACCGTCGGAAAGTCCCCTGACGACGTCTTTCGTCTGTTCGATCTCCAAAAGGCAGGAAATTCCATTCTCACAAACCCGAAGTTTACCTCATGGACC
ACATATGTGGACAACGTTAACGCACTGAACCCGGAGAAGGCAGCATCGACGATCCCAACGTTGACGACTTACTACGTGATGATATACTGTTCAAGATGCT
TGATGCCGCCAAGAAGTCGGACGAAACAAAGAGCATCGCCACCAAGTTGGAGGCCCAGCAGCTTCAGGGATGGCTGAAGAGTGGGAAATCGCCGGAAATG
CTTTCGTTCAGATGGGACTTGGCAACGTGGAGGATAATCTGATGGCGAGTCCGCTTTTCAGCACTTGGGTAAGTACCTGGATGATTTCAATGCGCAGTAC
TCAGCGAAGGAAACAACTCTGTTTCATGTTTTGACGAAGAGGTTCGAGGATGAACCTTTGGCAAAGATTATTGCTTTCGGAAAGACACTGGACAGTACGA
AGGCAGTGGCAGCAAAGTTGGAGACCAACAGAGGCAAGTCTGGCTGACTAGTGGTAAATCATCGGACGACGTCTTCACGCTGCTGAAACTTGACAAAGCA
CCAGACAATTTCTTCGACAATCCGCTGTATAAGACGTGGGGCTCGTACATGAACTCTCAACAACAAACATCCGGGGAAGCAAACGAACTTGTTCAAGACG
TTAACGACCAAGTGCAAAGACAAACCATTGATCAAAATCCTCGAGGAGGCGAAGAAGTTTCCGAATCTCGAAAGCACTGCCAGCAAATTGCAGACGGAGA
AGATCCAGAGTTATCTCGCCAGCAAGAAATCTCCCGATGAAGTCTTCACGCTGCTCGGGCTCGGCGATGCATGGGATAATGTTTGGCAACCCGCTGTTCA
ACGTGGCTCAACTACGTGAAGAAGTTCGACCGAGAGAACCCACGGAGAAAACTGATTGGTACTTGGCACTTCATGCGGCCTACGGTGATGGAGGAGTTGA
ATCGATGGTTAACAAGGGGCTGCAAAACCCAAGCACTGTGAAAATTGCTGAAAAGGTGCAGGGAGGACTGCTGAAGCGCTGGCTTATCAACGAGGAGTCT
CCAGATGATACCTTCAACTGGATTCTACGATATCCCACGGACGAAAAACTTTTTGCCGATCCACGTTTCGAAACCTGGGCCAAGTATCTG