Description :
From Genome Similarity Track
Location :
Scaffold_94:137500- 138564
Transcript NameFunction/comments
g11245.t1XP_009528031.1 hypothetical protein PHYSODRAFT_332693 [Phytophthora sojae

Sequence
1064 bases(100 bases per row)
GTTCTGATGGTGTGTGCGATAGATGGTCGCGATTGGTTGAAAAGCGATTATTGAGTGCTACCGTCTGACATAAAAATAAGTGAACGCGTGGCTCATAAAA
GTATTCAACATGGTCGCAGCAAGGCAGGCTACTTGCACCCGGAACCGCCGGCGAGCACGAGGCAGGCGGTGTTGGGGAAGACGGAGAGGAGATTGGTGGC
GACAGACCATACTAGAGCAAAAGTGAAGATGGCGACGGTAGCCACGCCGCCCCAGAACCACGACCGAGCTCGTCGCTTGAGTTCTTGGGTTTCGCGCTTT
TGAGGCGGAAGCAGAGGCAGCCACGCGAGCGACAGCAGCTTCATGACATACGCGATGACGAACGTCCAAGTGACTTGCCAGCGCACGTGCTTGGAGTCGT
GAATGATGTCGGTCACACCCACGTCAAAGAGCGCATTGACGTTCTTGGAGATGCAGGAGGCGAACGGGCTTGAGAGGTTACTTACGGTTGTGAGCAGGCC
GTACACAGCAGCTTCGTTGCCGAGCTCGGCCAGCTCCACCACGACAAACGTGGACACGAGGAAGTTCATGGCTTGCGGGAGCTCTTCCAGGATAGGAGTG
CCCAACCAGAACCACTGGCTGCGAAGGACGTCCCAAACGGTGAGCATCCCGACAATGGCGTCCAAAGCTATCACCGTCACGGTCGTCCAAGCAATCACGT
GGCGCCAATTCCACCCCAACCCAACTCGCTTCGCCATGTACAGCGCCGCACTGAACACGACGAGGCCAAGCACGGAGAACAAGCTCTCGTTGAGCGGGTG
CACACGGGCCCAGTACCGCTGAATCGGGTCACTCGCAGTAATCGTGAAGCCGTCGAAAATGCCGCTGAAGAATCGGTAGGCCAAGATCTGCACCATAGCG
GAGTTCTGAAGTAGCACCCACAGACTGCACATGTATTCATGAAACTGCGGCACACGGTCACCGATCGGGGGCTCTTGCACCAGCCACACTGCTGCAGGGA
TCGCGACAAGACTCAACAGTGAGAAGACCAGCATGAGCTGGCTCATTGAGAACGACCACGAGAA