Description :
From Genome Similarity Track
Location :
Scaffold_1045:1375- 3090
Transcript NameFunction/comments
Phyta_totarag11851hypothetical protein

Sequence
1715 bases(100 bases per row)
GgccaccagcgacgagctggacacgacggtGTTGCTTGCATATGCTGCCAGCGTTCCTTTTAGTAGGCCTGGGCGTCAAGCACACGGTAAGCATTAGCCA
AATATACTTTACAGAGCCGTAGTCAAAGTACTCACCGCCAACGTGCGCTTCCCTCGCCGTGGCACGTCGAAGGAGCGAGCCTTCCTTGCTTAGCAGTGTC
GCCTGGAATATGCTGATCTGGCGTGGGTGTGACGGTTCACTACGCAATGTACTGTTTCGTCCTTGCTAAATCAAACGCCGTCTAAACACAACATCAGTAC
ACTGGCCTAGACTTCTTACGGACTTTTTACGAGCCGCCACCCTTCCCAACTAACCTGATTTGACAGNCTCACCTAACCCGCTTTCTATTTATGTCTGAAA
ACGTCTGTAAAAAGGGTAAATGACGTAGTAAATCGAGGTTAAAAAGTATATGTGCGTTTCATTATAGGGGGCTTTGCCCCAAACATTTGGCAAGCACAGC
AATTGCGCACCACCACAATTGACAGAACAGTGTAGTGGTGTCTGAAGGTGAGCATCTCACATGAACCGTGAATCTAACATATTGAATGGACTGCGAGGAA
TTGATGCTGCTTCGCGATTACTGACGTGCAAGTACACAAAATCGTCAAGGTTACAGATCGATTGACGCAAAGTTTTCAATACTCGCCTATAGGGTAGTTC
TCAGACTTTTAGTGGTTAGATTTCAGCGACGATTAATTTTCTCTGCTTGTAGGCATTGCTGATACTGCTGGTCAGCATGTTCTTGCCAAATTGACCTAGC
ACTTTTCAGTGATTATTCTACATCGTAGTTAAAACCGCATTAATTTGTGAACAACGACTGCCTGGACGTTTCAGATGATTCAAAATGCTTTGTAACCCCA
TCACTTCATCAAGCAGTGACGTTAGTTCTGCTTTTCTAAGACGTTGGGTTACGATGGATGGGACCCTCGATTTTGTATTGTGCTTCGATCTTCGTATTGT
GCTTCAGTTCGGCTATCTCCGCTGACAGTGTGCGAATCCATGATTGTGCCTAGTTCTCGACAAGCTCAGAACACAAACTTAAATTACTCCCTGATACTCC
TGAGACCAGGATGCCCTGCCATTTCTTGTGAAATTCCGTTTCCAAGTTGGTTGGCGGCGAGCATGGCGTTAAAATCGTTTCGGTAATCACCAAGCTGAAG
GTGGCGCTACCAAGAAAGGCATGTGGACGGAGTCAGAATTTGGTGAGTACCACCAAAACCTTCAACGGCTACGAGGTCTTCACGGATTGCAGTTCCACGA
CCTGGACCTCAATCACAAGCACAATATTAATGACATAAAGGTTCCCTGAGTCACCCAGAGCTAAACTAAGAGAACGGCGTCTTTTGTCACCGCCCGGAAA
CCGTTCACACCTATTGAAGGGCGTGCGTATCGATGAACGTTTACTCGATGCGTGCGAGCTTGCAGATCCTCTGGGACTGAGTTTTGAGCAATCCGAGTAC
ACGCAGTATGTTGGACTTCGAGTCCGTCGACCAGGACAAGAAGTACAAAATGGACCTGGCAACGTAGACGTCACAGGTTTACTATTGCCGTATTTCCCTT
AGATAATTCATTGAGGAGAAATACAGCACCCGTAAACCTGTcagctcgcgctgcacgaCGACACGGTTAAAGGTTGCCACGCTGACTGACGAACTTATGG
CCCGCGTGGGAATGA