Description :
From Genome Similarity Track
Location :
Scaffold_40:1375- 2741
Transcript NameFunction/comments
Physo_538145YapH protein
Physo_538150PREDICTED: uncharacterized protein LOC101236728, partial

Sequence
1366 bases(100 bases per row)
AAATCTCCAGTGGAAGCAATGTTTGGTTGTGCAGCTGTAGACAGAGTTCCGGTTAATGTTGTAGCACTTAGCGATGAAATTCCAGATACTGCACCTGATG
AACTAATTGTCATTCTTCCTGTATTACTTGTTTGAAAGACTAAATTGTTTGCTGTAGATGTTCCAAAATAAGCATCCCCATTGTTAAAATGAAACAGAGC
ACATGTTGAAGTACCATTTATAGATCTAAACGATTGCCCATTAGCAGTTAAAGTAGCGGTTATTAATCCTGTCGTATTCAATGATGTTAAAGTTCCAACT
GAGGTAATATTTGGCTGAGCAGCTGTTTGAAGTGTTCCAGTAATTGATGTAGCCGTAAGAGTCGCTAAAGTTCCAATCGATGTAATATTGGGCTGAGCAG
CTGTTTGAAGGGTTCCATATAAAGTTGAAGCGGATATATTCGTAGCTGTCAATGTGTTATTAACAGCTACATTTCCATTCGTTAATATTGACATTTGCAC
AGATCCATTATTTGATGCAAAAGTCAATGGATGATTTGAAAACGTTTGGAGACAACATTGAGTCCCATCGAACCACTGCTGATAAATTACTGTTCCATCA
GTGATTTGATACAATGAGTTTGTTAATGCTGTCGATCCGATAATATCTAATTGTTTAGCTGGAGATGTATTATTAATGCCTACTAATCCAGTGGATCCTA
TCGTTATTTTTCTATTCCCATTTGTTCTCAAATGAAACTTATTCGCTGTTGTACTGCCAAATGTCTGATCTCCAGATACAGAATCAACAGATAATGAGCA
TGTGCTACTGGACAGGGAGTTATTACAAGTTATAGGAGTAGATCCACTAATAGTGAGTGTTGATGAAATTGTTCCCAATGATGTAATGTTAGGTTGTGCA
GGTGTTTGAAGCGTTCCTGTTAATTGTGATGCTGAGAGATTATTAATGTTCGCGATGTCTCTGTTAGAGTCAACCGCAATCAATTTCCCAGCGGAAGCTG
TTCCTGGTGTAATACCTGACAGCACACTCAAATCAATCATTGTTCCATTTTGATAGATATTTCCAGTGATGTACAAATCCGAAGTGTAATTCACCCCATT
TCTTTTGTTATATCGCAAATCGCCAATACTAATAGTCAAGTAATCCAATAAGCCGATATAGTCTGATGGATTGTATAAGGATGGAATATAATTAGGTGGT
AGCATTTTGTAAAACGATCCTTTATATAATATAACAGATAGATTTGTCATACAAGATGAGTTCAATTCCTGATTTTGGTGGAATGCTCCCAAAGGAGTTT
AAGAAGAAATCGTTTGGAGTAAACGAAAAGCTTGGTATCCAGAAGCTTTTCCGAATGATAGTTTTA