Description :
From Genome Similarity Track
Location :
scaffold_62:137483- 138658
Transcript NameFunction/comments
Plaha_PHALS_02520tkl protein kinase

Sequence
1175 bases(100 bases per row)
ACAACAAACAGAGCGAGTACCACGAAAGTGATAAAAAAGAATGTCAAAAACGTAGACTCTCCCGCATACATGGCACAATTTACACCCAATGATTGCGCCC
CACAGGAAGAACATCATTTAGATGTGAAATTCACGACTCGAGAAACTCGTGCAGCAGGCGCAACTGGCATCAGCAGCAATTCTAGTAGTGAATTGTATGA
CGATCTTCTGGATGATAGGCTGTTTGCGTCCCCTCTGATTCATGACGATATAAACAAGAGGCTGCAGCGACACATGAAGGCTGAAGCTATGCACGCTCGG
TCGTTGGAGAAGAATCGCCAACGAACTAAAGCACGCAAGAAGATAGGCATGTTCATTTTCTGTATTGGAGTCATATTGATTGCATTCATTGTGGTCTCAG
TATGGATTGCTAAAGTTGGTGTCAAAACTCAGGACAAGTTGATCAAAAGCAACAATAATGCAAAAGTATTAATAAGTAGCAGCGGGAGTGGCAACAGCTT
AGAAGGTTCTTCTGGTAGCATGGGATCCGAGGCAGATTTGATACTTGACTCATCTTCATACACGTACGTCCACTGTGTTCTAATGATTTTATCACTGTGG
ATGTCTCTCGTCGTGGTAATTATGCATATGACATTTCGTAGCTTTCGGACATACTCACTTCCCTTTGTAATGGAGCTGAGCTGTTTGCAATGTGGGTATT
GGACCACATCTTTGCTACGAGTAATGCTCGAGGCTTCTTCCTTGCCGAAGATGGCATACGTCTTTCTCTGCATGTTTGAGTGTTTCTTCACATTTGCATT
GATCTCGTTCGCGTGCACCACGGCTTATTATATGTACCGATCGGTGGTGTCATATGTAGACGTTATTATGGATTCGCACAGTGTTAAGTCCCGCCACCGC
CGGTGCACAATAAATGTGCTGCTGCTCTCCTTTGCCATTTCGATTTTATTAGCGCTAGTTGGTACCCGATTCAAAGATCGTCATAATTCGTCAAGCTTAG
TATTTGCGGGCGAAGAAAAGATTTTGGACGAGGAATCGATTTCACCTTGTCTTAACTCAAAATGCCGTCAGATATTGTACGTGTATTTTCCGCTACTGGC
GTTTGCCTTCGTCTTTATATTTTACGTGCGCTTAAAAGTAATCATCGGTAAATCATATCCGACATCAGCTATCGG