Description :
From Genome Similarity Track
Location :
Scaffold_157:137466- 141281
Sequence
3815 bases(100 bases per row)
CTCCTGTTTGACTATCTACGACAGAAGAAGCGCGAAAACCGTCTGCAAATAGTGCGAGGTGCGGGAGGAGGATTAACAGCTATTGCACCAAAAGTTACAC
CAACTCGGCGGACGACACAGGCCGAGTTGAGATGGGATGCTACTGTGTCGAAACTACATATACTGAATAATTACGAAAATGAAGTCCTGAACGATACCTA
CGGGACGCCCAGTCAAAGGAAGAAAACTAAAAAGTCGGCGATCCAGATTCCAAGTGAGTTGAACCCGACGGAGACAACTAGGAAGAGCTCAGCGAACTCG
ACGATTGGGGACGTGGCGTCGGAGCAGACGTCACCCCTTCGGAACTTGCGGAAGGAGATGCAACATTCGCAGCAGTGGCAAGAAGTATCATCGCCGAGCT
AGCCAACGAAGCTGATGCCGAATCAGGTGCCTCAGGACCCGACGCGGCGGAAGTGGGCTGAGGATCCGTTCCACTGGGGAGTGGGGTGCCGAACAGAGAC
ATACTCGGAGACGCGCCTCGGAGATTGGGAGAACCCAACCCATCGTCCGCCGAGTCGTCATCAGACGCACGCTCGCCATCTGAGCCGAGCTCACCGATCG
AAGACCCAGTGAAGATATGGATGCCTTGACGATTCAGCCGAGGTGGAGCACCTGGGGCATAGGCAGGAGGCGCTTGTTCAGCAAGATCGAACTCTTCTTC
AATCGCGTCGTCAACAACCTGAGGATCCATACCGCGCGGAGCGAAAACTAAGAAGTCCACGTTCCGAGCGCGGAAGCAAGTATTGTATGGATGGACCGCC
GGGTCAGTCAGCCACCAAGCTCGCCAGGGCTCGGCTAGATCCACATCGTGAGCACACTGGACCCAATCTCTCCCGGAAGGAACCCACGAAAGGTTAACGG
GAGAGTAATGGGGGAACGGACGGATCGAAATAAAACTTCTGCGTCCACTAGAGGAGCAGGTTCATCGCCGAGCTTCTGAGTGACCGCCGAGTAAAGCTGG
TCGTAGACAGCAAACAACCAGAGATCGCAAGGTGTCACTACGAACGTTTGCGCTCGCGCGTTGTACACCAGCCACAGTTCGTATACCCTCAGCGGAGCTG
GGCGGGGCGGTGGCAGCCGGGGTTAACCGTCAGGGTGGAAGACCCATCAAACACACTTCGACTTCTGACGATCCGATGTGCGAAGGCTCCTATGATAGCT
ACCAAAGTAACGGAGCCCATTTGGCCGTCCTGCCCTGGATAGGGCCCTCCCCCGCCGATCATAAGGGAATTTGTCGCCGCGTAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTGAAGAGTCAAGCGACAATCCTTGGAAACCGCT
TGCGAGGCCCGGGTCCGTAACGTCGCCAGCGGGAGTGTAAGAGCGCTGGGTAGAGTGACCAAAGCCGGACGTGATACAGTCGAACTCGGCTGAGAGGGAA
TCGACACTACCGGGAGCATACTTGGCGAAGGAGCAGCCGGAATGGATTGGGCAGGAGCCGGATCAGGGGTTGACGGAGGCTGCCGATGCTTGTGGTGCCG
GTGCTTCTTGTGATACTTCTTGTGCTTCTTGTGCTTCTTGGACCGCTTCGACCGGTGACCGGTAGGACTCGACGAAGCACGACGCTTGCGACGCTGCTGC
TTCCCCGAAGCCGACGCAGAGGTAGAAGTAGAAGTCGTCCCGTCACCAGAATCCATCGATGAATGTCGGGAGGAGTGGCGATTACTCGGCGGCAAGGAGG
ACTCATCACTCATCTCATCGTCAGAGCCGAAGATTGCCGCATGCAGACTTCTCGCTTTGGCAGAACGACGAGCATCTTCGGCCGCTGAGTCGGAACCTGA
GAGACGGCCAGCCGAGTTCTCGGATAAGGAAATGGGATCCAAGAGCGACCCAGCGGCAGGATTTGTCGAGCCGGTAGACAGTGCAGAACCGTCGCTAGGC
CCTAACACCTCGTCGTCAGACGCGTCAAGGTCCTCAAGCAGCTGAGCAGTCACAGTGCGGGCAGTCGCAGCAGATCTCCGGATGGGGCGCCCAGACGGGG
ACGTCAACACAGCCGAGCTCGCAGGGAGAGACGGCCTGAGGACACTCACAGCCGGAGTCACTAGGTCAGTCGGCGTAGTGGACGCTCAGACCCCTAGAAG
GAAAGACGTGGGAGGATCGGCTAGATGACGACTGGGAGCGCCCAACCACCGTGGATACGACGCTGAGCGGTGCACTTGACTGGGGCAACCCAGCGAGGAC
GGGCGAAGTCGAGCCTGGGGCACAAATGTGGTGTAGTAGAACACACAAATACCGTCAGATGTGGATTCCTTACACAAACCACAACGAATCGCCGAGTTAG
GTCGGCGGTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCTCTTCCGGGACAGACGGGTGGCTCGCTTCCACTCGGTTCCGACTAACCAAG
TCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACGACGGCACGCGGGGTCTTCC
TCCATCAGATACAGTAGCTTGAGGAGAACTTGAGTGCAAAAGGGCACTGATAGCCTCGTGCCCATCCTCCCCGGGAAGTGGACAAGCGTACGGCTGAGGC
GGATGCGGCGTCGGTGAACGATGACGAGGTCCTGCAGCAGTGGGAAACTTGGGGTTGGCATAACGTCGAAGCCGCTGAGTCGAAGTCAAGTTCGCCAAAG
GTGTCCGGTGAAGCTGTGCGAGGGTCGGCTCGGGTTGGCTCGTAGCCGCCGCTGAGCTGACTGGAGTCGCAGCCGAGTCTGCCAATGAAGTCACAGAAGA
CGCTTGACTAGCTGGGAGGACCACACTAGGACCAATGGCGGAACTCGCCACTGGAGCATCTCGGCGAGGATGGACAATTAACTCCAACCGCCGAGTTTCA
CCAGCTGGAATGTGAAGAACCTCAGGGAAGCGAGACTCCAAGACACGACACAGCCGAGCGTTAAGGAGAAGGTCGGACGGATCAAGTCCAGGAACCTGCA
ATCCACCGCCAGCAGCAGCAGCCATGTGAGGGTCGTGCATCGGAATAATGCCATTCCGACGGATGAGCCGCTTCTGTCGCAAGATCACAGCCCGCTGCTC
AGCGATCATCGACTGAGCGTGCCGCAAAGGTTGAGTGCCGGTGGAGCTGTACAACCGCACCGACTCCTGCAGCTGTTCGAAGTGCTTGGAAGCAATTCCC
TGAAGGGTGACGAACGCCGCATCCCTCTCAGAAATGGATCGGAGAAGGACGTCGATCTCGGCGTCTCGATCCAAGACTTGCTGATGATGGAGCTGGGCCT
GACCCAACGCAGCGTCAACCTTGCTCTGCTCAGCTGCGATGGCCCGAGCAAGTTTTGCCTCACTCAGAGCTACAGCCTTTCGCAGTGACGCAAGGAGATT
AGCTGACTGCGTGGCAGCAGCCTCCAATCGGGTCACCTGCTGTCGTGCCGATGAGAGCTGAGTGGACAAGTCGACATTGCTGAGAGCGAGAGAGTCCTGT
CGCCGAGTCAGTGCG