Description :
From Genome Similarity Track
Location :
Scaffold_8:137406- 141452
Transcript NameFunction/comments
Physo_129516reverse transcriptase
Physo_129517reverse transcriptase

Sequence
4046 bases(100 bases per row)
CCCTTCCTCCTTGATGCTGCAGCCGTCCTGCAGATCCTTCACTTTGATCTTCACGTCGGTGCCCAGCCCACCTGCGTGGCTGCCTCCGTCACTCTTCCTC
GTGTGACTACATGGCTTGGAATCGATTCCGTTTCGCATGGGCGGTCAGAAAGTCGTGGATCAGCGCGCCGCAGTTCAAGTCCGCCTCATCCACCCACGAG
AGCTCTTCGTATCCTTTCCACCTGATCTGAAATTCGCGCAACGTACGTCCATAGCGCGTCTTTCGTCCAGTCCTCACGTCCAAGATCTGCTCCACTTCAA
ACTCGTCTTCTCCCAGCTCTCGATCCCAGCTGTCTTCTGGCAGCAGGGCTTCATCGAAGTCTACTCGATCGGCCTCGTCAACAGTTAACTGGATCCGCGG
GCGTTCGGGAAACTCTCTCATCAGCTTCCGTTTGGCAATATGTACCACCGGAAAGAGGTGGTACTCAGTCCCTGCAGTTTCCAACCGCACCGTATACTCG
TTCACCATCTCTAGCACTCGGAAAGGCCCGTGCCACATGTGCGCGAGCTTCTTGGCATAGCCCTCCTTCACTCCATCCAGATAGAGCGATACGCGTGATC
CAGCTTTAATATGGTGGGGTGTAGCCTGCTCGTTTCGCGCTTCCGCCCTTTCAGCGATTGCCTTCTTCAACTTCTCGTTCACCTCTTGCCTGGCAAGTTG
GTAGAACTTCTGGATCCTGTACCGCCAGCGGCGGGGATTCGAGTCTCGTCTCTTGGTGCTGCCTACGGGCAACGTTGCTTCCAAAGTAGTCGTAGGATCC
CAACCATGCGCTAGATAAAAAGGCGTATCGCCCCTGATCCGGTCATGAGCCGTGTTCAGTGCGAACATTAGCCGTTCCGCGTACTCATCCCCGTCGCGCT
GATCTTCATCTTGGACATACATCTTGATAGCCCTCGTGATAGTCTGCACCATTCGCTCCGCGGTTCCATTTGATTGTGGCCGGTAGGCCATAGTGGCCCG
CTGGCGCTGACCTAAGATGCGGTTGAAGGCGCGAAAGAAATCCGACATAAACCCGGGCTCACGATCGTGACGGATCACCTCGCTCGCACCGAAGCGGCGG
AAAACACACTCCTTGTAAGACTCAGCAATCGTCTGCGCAGTACGCGATCCACTGGCCTTCGCCACCACATAGCCTGTGAACAGATCCACCCAGATGAGTA
GTTCGGTGTTGCCCTTCTTTGACTTCGGGAGCGACGGGGTATGATCCATCGCGATCACCTGGAACGGATACGTCGCTCGGATGTTCCCTGGGGACCTTCC
TCGGATCGTCGGTCGCCCCTTGCCTGTCTCGCAGTCGACACATTCACCGACAAACTGCTGCACCGACCTAAACATCCCCCTCCAGAAGAAGTGAGGTTTG
ATCCGTTGATAGGTCCGACTGATCCCTTGGTGCTCCCCTTCCAGGCTCACATGGTAGTGGTGGAGTAGGTCAGGTTGTAGAGATTCCGGCACGACTAGTC
GAAGCAGGCCGTCCCGGTCCGCCTCTGTTCTTGCCGACGGCGCGCAATAGTACAGCAGCCCTTGGGTATCCGTTTCGAAGTCTGCCGCTAACAGGCTGCA
AGCCTTTGCCTCCGCCTGCGACATTGCCTGTACATTCCCTTGTAAGTATTGCTTCAGCTGCTGGATCCATGCCTCTTCTTCCTGGGCCTGGCGGATCCGT
TCTACACGTAACTGTTGCACCACTTCCTCTTCCAACACCTTCGCCTTCGCATTCCTTCCGGCACTGGATCGAGTGTGCATAGCATCAACTTGGACCACGT
CACCCGCTGTAGCCGGCATCAGCACTTCCTCCAGTCGGTTCAGCGTGATCAAGTCTTCCGCTTCCGCGTCTGTCTCCACAGTTCTCCCTTCTTCCCGTTG
TAGAGCGGCGCCGGCCAAACTGTCCGCACTCGCGTTCCATGCTCTCTTCACGTGTAACAGGTCGTGGGTCGGCCACTTGCGCAGACATTCTAGTGCCTTC
TGCCTCGAAAGCATGAGACTCGGCGCTTTGCAGTCAATCTCCCCACGCATCTGACGGATCACCAGGTTGGAGTCACCGCATACTATCAGACGTCGCAGCT
CTAGCCCTTGTAGCAATTTGAAGCAGAGTAGCAGTCCATGATATTCCGCCTCATTCACGGTCATGTCGGCCGCATATCTCGATGCTGCGGCGACTACCGT
CCACTCGGGCAACTTTCACACGATCGCACTGAAGGCTCCCCCACCCCTTTTCACTCTGGCGGATCCATCGAAACTTGCCACCCATAACTCTTCCTCAAGC
TCCACTGTAGGGACTGGCATGGATATCACCTTCCGTGGTTCCTTCCTGGGGGCGATTGCTGCTAGTGCCTCATCCATCTTCTCTCTAGGGGTGATGCAAG
CTGCTAGCGCCCCTAGGATCTCGTCCTCGCCCTTGGCGCATCGCTCAATTTCGATCATCCATGTCGACAACAACGTAGCCCATTGGCTCAGGCTGCCTTG
CAGCCCCGTCGACCTGAACAACCAGGCCAGCGTGGAGTGGCGAGTTAACACCCGGATCCGTCTTCCCACCAGCATCGAATAGCCGAGATCCAACATCCTT
AGGATCGTCAATACTTCCTTCTCCGCGATGCCATACTTCAGCTCGTTCTGCTTCAATGTCCGGCTGACGAACATCACCGGCATGTATACGCCGTCGTGTT
CTTGCATAAGTGACGCGGCGATCGCCCACTCGCTTGCATAGACGATCACTACCGGCTCCCTTTCCGCATCGAAATGGCGCAGGATCGACGTGGCCGCTAT
CTTGCCCTTCAGTGCGGCGAAGGCTGTCTCGGCTCTGCTTCACTTCGTACTACGATCCTCCTTCTTAACATCGTCGTTGTTGGGTTGCTCCTCCGTTGAC
CGCTGCCTCAGCTCTGCGAAGTCGACCTCTCGTAGCTCGTACAGTATCGCCGCATATACAGCCAGGTTCTCGATGAAGCGGCCGTAGTAATTCAAGCTTC
CAAGGAACGACTGCGTTGCTCGGAGGGACTTCGGGAACGGCAGATCGGTTAGAGCTTGCAGATCCTTCGGTTGTGCCTCCAGGCCCCCAGCGGACACTCG
GTGACCGAGGTAATCCACCTTCTTGAGGCCCCAAAAACTCTTGGCTACACTGATCGGTAGGTTCCACTCGTTGCACGCTTCCAGCCGTTTCCGCACTCGT
TCACACAGGTGATCCCACGACGTAGCTGTCACCAAGATGTCATCAATGTACCAGCGCAGACGGCTCTCCCCCATCATTAGGCTCGCCCTCTCTGAAGAGA
TCGACGAGATCTTCTCCTTTCGAAGCTGGCGGGATCCGGAGGAAACCATACAATGCGTTGTCGATCAATCTTTGGTAGATCTGGGGCGCGTTCTTCAATC
CGAATGGCATCCTGTTCCACTCGTAAAGGCCAGACGGGGTGATGAAGGCTGAAATTGCCCGCGCACGCTCAGTCATCGACACCACCCAAAACCCGCTCGC
CATATCTAACGAGCAGTACCACAGCGTCGCGTCGAGATCCTCCAACAGGTCGTCGATCAGAGGCATGGGGTAGATCATCAACCTCGTTAGGATGTTCACC
AACCGATAGTCGATGCAGAGGCGAATATCTACTCCGTTCTTCTTGATGATGACCACAATAGGGGATGCCCATGGAGACGTAAAGGGGCTGAGAATCTTGG
CCGAGAGCAGCCCCTTGAGCAGATCCGCGAGCTTTTCCCGATATTGCGGGGCGACCTTGCGCACACGCTGTGTGACCGGCTTCGCATCTCCAACGTCGAT
ATCGCAGACTGCGCCGACGGCGGCCGGAGGTAGAGCGTTCCCTTTGTCGATGAGGAGATGCTTGTACGCCCAGATCTCATCGATGAGGTTTTGGATCTCT
TCTGGGGAGTTCGCTTCAGCGTCGCCTACATGCAGATCTTCCACCTTGACCTCTGCCGTAGTGACCGTCACTTCGGGCAGCACCGCCAGCTTTCCCTCGT
AGTCCTCTGCGTACAAAGCACTCGCCCTGCGCTCGTACGTCTCCTC