Description :
From Genome Similarity Track
Location :
Scaffold_1107:1374- 6438
Transcript NameFunction/comments
g15171.t1hypothetical protein

Sequence
5064 bases(100 bases per row)
GCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGAC
CAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGTGGTGCTA
CACGGGTATTCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTT
TCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGA
GCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTGTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCA
GGCCCTCGATGCCAACGCGTCACCACAAGGATACGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTG
GCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTAGGGGGGACGTCGTCACAGTTGCAACGGGTGAAACCGCCCCTCCTGTGCCGA
CGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCA
GCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGGAAGCTAGCCCGGCGAGCCCAGCTCCGT
GCCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCACAGCAGGAACGTCGGCAGAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCA
ACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACTGAAGAGCGCAGAACAGATCGTGAGCAACACGCGGAGCGCCGGTCTCAGCTCACGCA
GGAGGAGCGTACCGAAGAACGGTTGGTAAATCAAGAGCAACACGCGGAGCGCAGATCACATCTCACACAGGAGGAGCGTGCCGAGGAGCGGATAGTAAAC
CAAGAGCAACACGCGGAGCGCCGTTCTCAGCTTACGCAGGAGGAGCGTGCTGAAGCGCGAAGGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAAC
AGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGT
GGCCTACGTCCAGGGTCCAGACGTTGTGAATGGACGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGAGAATCA
AAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGC
ACACACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCGTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGG
ACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGTAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGAC
CCTAAGTTCGCGCAGATCTATATTGTAGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGG
ACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCTGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATAT
GGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGAT
AGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTACCCTCTTCTGCTTC
CGTATGGGGAGCTGGGTTGGATCTACACAGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCG
GCTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTCCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAA
CTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACAGAGGGCTTCAGGACGCACTGCTGAACGAAGGTACAATTCAGCTGGAAGCAG
GCGAAGGGCTACTCTCTGAGTTCGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACG
CCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCAATGTACCAGTCCTACCAAGACTCAGTGGCCATTGTTAGAGAATTCGGCAAGCCTGAT
GTGTTCATGACAACGACCTGCAGTCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCC
GTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAG
AGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGAC
AGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCATGTGGAGCAGCAAACCCGTCATGCGCTTGCATGAAGGACGGGA
AGTGTACGAAAGGATACCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCT
GGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTC
GAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTG
GAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGAT
CCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTTGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTCGGT
CGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCA
AGGAATTTCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGA
GCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGAT
GCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCT
TTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCCTACAGGAACTGAGA
GATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGCTACTCCGTCCAAGACTTTGAT
CTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTG
AACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCT
ATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACGCTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCT
TCCAGTGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCATTGAAGATAGACGGCGAATCTACTTGCAACATCA
ACAAGCGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGATAG
AACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCCGTGGTGAAGGGC
GGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCTTAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGG
CTGCCACGTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGA
CTACATTAAGATTCCACGCGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAG