Description :
From Genome Similarity Track
Location :
Scaffold_2879:1374- 2658
Sequence
1284 bases(100 bases per row)
GTCGATGGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGA
TCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGCTTCAGCACATCGAGACGAAAGTGGCGTTT
CACCTAAGCGAGCTCCAGCGTGGGTTTGCCGACGGATCGCTCGATGAAAACGCGATCGAGAACATCGACGAAACTCATTTCGTTGTCGACTTCGACAACG
GCAAGACGCTTGGGTTTTGTGGCGACGAGACTGTGAAGTATGCTGACGTGGTCTCCGGAGGTGAAGGAATGACGATATTCGTGCGACTCTCAGGAGGCCC
AAGCGCTCGGATTCACCCACCAATGATGATCTTCATGAATTTGGCGGGGAACTATTCTACTCACGGAGTTCCAGACAAGATCCCTGGCCTCTGCTATCGC
TCAAGCAAGAAGGGGTGGATGACTCAAAAGCTGTTTCGTGAGTACCTAAAAGAAAGGAGGGCGAAGAGAGCAGACGTTCATGGGCGCAAGAAGACGTTTC
TTTCCTCGACAACTGCTCCGGCCATTTGGAAGCGGAAGAATATCGTTCAGAGCTCGACGCTATCAGCTCTAACCTCAAGTTCTTTCCGCCCAATACGACG
GATTCTGTGCCAGCCAGCTGACGCGTTCGTCATTTCCAAGATCAAGGACGCGTGGAAAGTCAAGTGGAACGAGAAGAAGATGGAGTTGATCAAGGAGAAC
GGGTGGCAAAACAAGGTTCGCAAGGATGGCTCGTGGTCAGGCAAGCTTCAAAACCCAGGTAAGATGTTTTTCTTGCAACTCGCTTCAGATGCGGTCAAGG
CGGTCAATCTTCAAAGGGATAAGAACGGAATGTCATACGCGCGAAAGGCAATGATGCGATGCGGTCTGTCCCTCGGCATCGACGGGACGTGGTCGGTTTC
TCAGCTTTACCCGCATCTCCAAGACATCATCAAAAAGCACGAGGCCCATTTTGAAGGCGAGCCTGTTGACACGGAAAACGCGTAGAAATACAGCAAGGTG
GTCATTTGATAACATAGATATAAACATTGGAAAGAACGAAAATTTAGTCTTAGTTGGAGCAGTCGTCTGAGCGACGAACCTCCACGCTGAGGTTTGACGG
TTCGAGTCTCACGTTTTGTGTATTTTTTTGTGACCGGTCGAAATTCATAAATAGTCTTAGCACTTAAATAGTCTGTGTCAGACT