Description :
From Genome Similarity Track
Location :
Scaffold_679:13738- 15256
Sequence
1518 bases(100 bases per row)
CCGTCACCCATCCAGTTGCATGCGCTGCCGCTCGCGCTCTTCGGGAACGACGTGGTCGGCCAGGCCAAGTCCGGCACGGGCAAGACCGCCGTGTTCGNNN
NNNNNNNGCCGTCGAGCACGCGATCTCCAAGTGCCAAAAGCAGCACCAAGAGTCGCACAGTGGCGTCTTTGGCGTCGNNNNNNNNNNCCCGCTCGCGCTG
ATCCTGGCGCCGACGCGCGAGATCGCGTTGCAGATCGACGCCGNNNNNNNNNNGCGCGACATCGCGCGCTTCCGCCCAGCGTGCGTAATCCAGACTTTCA
TTGGCGGTCTACCCATAGCGCAAGATCNNNNNNNNNNCTTGCCAACAAGGATATAATTCTTTCCCATCTCATAGAATGCACATTTTGGAAGTCGCCTGCA
ATACTCCATTTGCATATGCTGGATGTGATGTATTTTCGACAGGAGAAGCTCAAACAGGACTGCCACATCGCGATCGGCACCCCAGGCCGCGTCAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCGTTGAGCAGCGCATCCTGCACTGCCACATGCTGCGGCTCCTAGTGCTAGACGAAGTGGACAAGCTGATCCAAAG
CGACTTTGAGAACGAGGTACGCTGCGACCATGGTGCAATGGGTATAACGACGTTATCAGGGCTAATGAGGATTGAATGTGTAGATCCAATACATTGTGCG
CGCATTGCCAGAGAGACGACAGGTTCGTACCGCGTCATTCTTACTACTCGTCTGTTATGTATTGCACCATTGTTGTATTGCAGATTTTGTGATTCTCTCT
CACTTTCGATAGACGCTTGCATTCTCGGCCACGTTTACGACGGATCAGTTGGCCACCGTCGCACAGATGATGCAAAATCCTCAGGTACGTAACCATCTGC
GCACTGTCCGTTGATTAATCATTTCCCATTGCTGCTGACTGACTGCTGTTGCTGCGTTGTCTTTGGCAAACAGATTGTTCGCGTTCGGGGTCCCGACGAC
GTGAGTGTGGAGCTCGTGTCATCATCGCTCGAGGACCTCTCGGCGTGGAAGCAACGCGAGGAAGCGAACGAGAACCCGGAGCTCTGGCTGCGCTACGTCA
AGCAGTTCTACAGCATCGTCCCTAGTCAAAGCGACAGTAGCGACAATCCCGTTGGCCGAGAGGCTAATGATGCGCTGGGCATGAGGGCAAAGGTCGTGAA
GCTGACGGCGCTGCTCTCTGAGGTCATGTTCAACCAGTGCATCGTGTTCTGCAATGATAAGTTCCGCGCTGAAGCGCTCGCGACCGCATTAGAGTCACAA
GGGTGGCCAGCAGCGTGCATTACAGGATCGCAGAGCCAAGCAACCCGAAGCGATGTGATGCGCCGCTTCCGCTCCTTTCACACGCGTGTGCTCGTGTCCA
CAGACCTTACTGCCCGAGGCATCGATGTCGACAAGGTCAATTTTGTCGTGAACCTGGATCTGCCGCGCGATCCAGCGACGTATCTGCATCGTGTTGGCCG
AACAGGACGCTTTGGTGG