Description :
From Genome Similarity Track
Location :
Scaffold_7:1373473- 1376721
Sequence
3248 bases(100 bases per row)
ACACTGAGGATCGGAGTGGTCGTTTCGCGGGCTCCCCAAGCCCCCAGCACTGGCTGCATTTGACGCGCAGCAGCCCGCGCTAGTGGCTTCCATACTGCTC
TCGCTGTTTCCCCCCCTCACTTTCGGAATGAGTGGTAGCTGACAATGATATACATGTATACATACTTGACGGATATCGAAATTTCTGTCGACCGCGCCTC
TTCTGGGGTAGGGGAAAATCTGGTCGCGATTTACGACGCTGAGTTGGGTGCACTACTCACTCTCTAAGTTTTTGGACCGCGTAGATGTCAGGGCGCTGGT
AAGGAGCGGTGCCGTATAAGGAACGGAATCGACCTGAAGACTGATGTCGAGTCTACCAATGCCGTAGCGGATGACGCTGGACTTGCGGTTATCGAAGATG
ATGCTGCTGAACAAGTGTAGGTCGAGGCGGACGCAAGCGCATTAGCTATGGTCGAGGTAGACGGCGCCGGGTCGAGGCTGACGGAGCTGGACTCACACTG
GATGGAGGTGGTGCTAGGTCATGGTGGTAGATATGGCTGACCCCGAGCTTCTGCTGACTGCACTGGAAGCACTGTTCCTGATTGAATTAGCGCGGAGGCA
CGTGATTAATTAAGAACACGAAGCACGGAGGAACACCGAAACAGGATAAATACAAGATGGGATGGAGGGGGCGACACGAAGAGCGGAATGCCACGAACGT
TGAAATAGGACTAAATGAATGAAGCACCTAACAATTCTGAAATGCACGAACTACAGACGAGCACGCTAATATTAAAATTAAAAAAACTTTGAGCATGACG
GGAGCGTACGGGATACGGAAGGTCATTGAAATAATGACACCCCAACAAGTTGAAAAGCACGGGCTACAAAAGAGCACGCACGTTCGAAGCCACGGTAGAA
CACGTAACAGTATGCGTGCACGGACAGGAATTCTCCCATAGCACTACGGTAGAGCAGAGACGGAGCACAGTCGACCGACCAAACATGAAGCCGCGGTAGA
CCATAATTGTCGTGTATTGGAACACGATACCAGGGTAGAACCAGATCTCAGTGGGGAGCGCGATAGAGATGAGCCACACGAAGTGAGGTAGAGCACGTAA
TCATCAAGCTCTCAAAACAGTAATGAGCACTAGTTAGGACCTTCGTATATTCCGTAATGATCGTTACATTCTCTCTCCTGCCTCACTTAGTCTTACACCA
ACCTGTCCCAAGTTTGGGTCTCGCACACTAACACAATATTCGCTTCTGCGCCAAGTCAAGTTCAGTAATCCCCAACAGCCCCACATACTGACCATTGGCG
TGGCGCTGCTTAAACGCCTCCTTTGACAGCAACCCCATAGTAGCCCTGTGCTTTTCAAATATCGTTCGTGGTAGCGGCTTGGTAAAGGCGTCTGCCACAT
TTTCGAGTCCTGGTACTCATAGTACTTCAATATCCTTTAGCTCAACTCGTTCTCGTATGAAATGGTGTCGTACATCGATATGTTTGGTCCGCGAATGATA
GACGGGGTTGTTGGCTAATTTCCTGGCGCTCTCATTATCCACACAAACTTGTGACGGCCGCCGCTGCTGAGCTTGTAGCTCCTTAAGCATCTGTCGCAAG
TATACAACTTCTTGTGTCAACAAGCTTAATGCCATGTACTCAGCTTCCGTAGTATGCAGTGCTAGTGTCTTCTCAGTTTGATTGCACCACGAGATAGCAC
TCCCGCAGAATAGAGTAAGATTCCCTGCTACGGACTTACGATCATCCGGTCGATTCGCGACGTCAGCGTCTGCGTACGCTCTGAGATGATCGTCAAGATC
TTGGTCGTTCTACTCCAATCCACCAAGTCGAATACCCATAGCTTATGGTCTCTCTCAAATATCTTAGAGCTTGTTTTGCTGCGCTCCAGTGCATAACACC
AGGGTTTTCGAGAAACTGACTGCATTCGTGTACTACAGTGCGCGCGGAAATGATAGACGAAAACTCGATTTCAAGCCAATTTTTGTCAAATCAAAAGCTA
TGAATTTGGGCTTTATATCCAATCAGGAGAACACCATTACGGTTCTTTTAAGGTACTGTTTGTTGTAATCCGCAAAGTAACGGCTGAGAAACACTTCCAA
ATCTGCTGTTGTGTTGGAACCCCCTGCGCGAAAAGTATAGCCTAAGTGCTAAAATCTGCTTGTTGGGAGACAACGATGCTGTTTACAAGGACCACCTGGC
TTGTAGTGAATAAGTATGGCCTAACAGAAGTCGTTATGCATTTGTTGTGTCATAGTATGCTGTATAGGGATGGGTAGAGGGGCATCGCTGTCGGACATGG
AGAAGGGAAGTATTTTGGCCTACAAGGAGGCAAACATGTCCACTAACGCAATTGCTACGCGTGTGGGACGTTCCTGGAAGGTAGTGAACAACTTTCTAAA
GGTTCAGAGACGTATGAAACCAAGAAAAGCTCCGGTAGACCAAGGAAAATGACACAGACAGCGGAACGCCGCTTACTGCGTGAGGCCTCTAAGAGGGGGG
TAAGCGCTCGCACGTTGAAGGAGTCTATGCCAGATCAGGCCTCGTGCCCAGCATCAAGTAAATAAGGCTATCTACAACAGCGCAATATGGTTTCGACTGC
ATTATAAGAATAAAAATAATATTTATTACATCTTAGACGAGCATAACTGCGTCCTCCACCACGACCACGAGTTGAACTTTGACCTCGACGTCGACCTCGG
CCTGAACCACTGAAGAACGCCTTCTCTTCCATTTCTTGCTCAAGCTTTCGGCCTTGTCGTCGATCGTACGCAATCTCGAGAGCTTGCTCTATTTGTTCGT
AGTTTGGCGGCTCATTGATATCGATTGGTATATGACTGGCTAAGAAGGTTTTAACAACATTATCGTACTCTGTTGACAGCGATCCAATGAGCAAAGCGGG
TTTGACATAGTCATCGAGTGGCTTGCCAATCAATGCAACCCGATCCATTAACCGCCGGACTTCACTTAGATGATCTGTTACACTAGCCGACCGCCGCCGC
TACGCATGCGATACGATCTGCACCGAATGAGAAAAAGGCTGACAGTAGACAAAAACGTCAACAACTTTGCTGGATATTTATTAGTTTGCAATGGTGTGGG
TCACACAGCCCAACCCCCTGTTCAGTTCCGCCGTCGTCGGACTTGACCACCGGTCGATCGGTGGCGTGCGCCTGCATGTACGCTACGTATCGTGCTGGAA
AGTGTGCACGTTCTCTAGGGGTCACACACTACGATCATATACAAAGGC