Description :
From Genome Similarity Track
Location :
Scaffold_42:137318- 139429
Transcript NameFunction/comments
Physo_135970hypothetical protein
Physo_135971hypothetical protein

Sequence
2111 bases(100 bases per row)
GCTGACTAGGGTAGCCGTGTTGGTACCGCTGGCCATCATTGTCGCCACGAAGTCCGGGTGGCGCTTCAGGACATGGTCGAACAGGTTACTGTAGCCGGTT
TTGGGTGCTTGTTTTCTGACGACGGAGCACTGGCAACGAAAGTACGACGTCGGCTCATCTTGAGAATCCGTGACGGCCTTGTAGAAGTAGCTGCAGACTT
GGCGGGTGCTGAACGGGTTGTTGGTTGCCATCTTGATTCGAAAATGAGGACGACACTAGGAAAGAGACAAACTTGGGGATGCTAGATTGTTAACTATGGT
AAGGGTGTTCTAACCAGTGCTTTGTGGCGTCTAGAAATGCAGCGGAGACCCAGAAATGCAAAAAGAGTAATTTCCTAGGAGGAACGTACTTATTTGAAAA
ATGATTTTTACGACTGAAAAATACTTTGTAAAAAGTCAAGCCGTAAGTTATTCCACTTTTTTCACGGTCGCGTAAAATAAATTATTCCGTACTAATATTT
CCATTGCAATCTTTTATTCGGAAGGCCAGCTTCGGAACGGCCTTCCGACTTTCGAGCGAGACAGACAACGTAACACGTACCCTCCGTTTATGAGGGGACC
GGGCAACTTCTCAACTCTTTCTGAAGATTCAGATTCCGATACGCCGAGGAGGAGCTCAGGATATGCCACGGCATCTATGAGATCAGGACCGAGCAACGGC
GTTGTAGGCCAAAAGCGGCGCGCTAGTAGCCCCCCGCGTCCAGTTGGCAACTCCTTTTTGAGGCCGACACCTCCTGGGCAACTTCTGTTCCCACGCCCCA
TCGAACGCGAGAGCATTTGGCCACGGTGTGGTGAATACTGGATGCTCAACGATCGCCAAACACCACGCTCGCCTTTGCCACAGTCAGAGAAAAAGATTAT
TGATGGCCTCAAACTGCGCTTGTCCAAGCTTCCGGATACAGAGCAGGAGGGTGTATTTTCCGCGAGTATCAAGGCTGCAATTGAGGTCGTGCAGCTGGAG
CAAGTGAAGGATGAAGAGTTACGCGTCGAGCAAGCCGTTAAGACGGCGCATGCTGCCGTCAAGTGCTTATTAAATCGAAACGGCAGATCCCCCCAGTCGG
ATGAGCAGCAGCACCGCTTGGAGGATGTACGTCAGATTCTACTCCTGTGGTGCGTGCTATCCTCGATACCAAAGGAAAACTCGAAGGCGCAGGACTGCGC
GATTTGCATGATCTCACTAAAACAATCGGGGAAGCCTCGCGCTTTAACTGGTACGTGTCCCGATCTCGGAACGCTTGAATTCTTCGCACTGAAAAATGGA
TCATATTCGCTGATTATTGTACATCATGCTCATGACTGCGTAGGTGCAACACTCAGCTACGCAAGTTCCTCACAGCCAAGTACAAGAAGCCTGCACAGAT
ATCTGCTGATGATCAAAACAAGTTGGTCTCACTTGTGGCTGAGACCCGGGACTGGCGGGGCATAAATGACTATACAGTCGTAAGGTTTAAGGAAATCATG
GCGTTTGTGACGGAGATATTCGACGGGTCCTATGAAGACTGGGAGCCACAACAGGATTCGAGAGTCGCAGAACTTGTCGGCATCATGATCGTGAGTCATA
TCAAGTGTTCGAGAAGATTCTTTACCTCATGCGCCTGATGGCGAATGAGGCCAGAATACCAGGAATATTCCACCAGGTACGTGCACGATGCTATTCTCGT
GTTGAGCTCTGGTCAAGCGAATTGATGGTATGTTGGTTCTGTATATCTCAGCACTGTCGACACGTTGCTCTCACTCTTCCCGTCATCCAAGCGACCGATG
TTCGAATACTCGCCAGCGACTAAATCCATAGATGAAAGCAGCTATGGGTCCGGTGAAGACTAGTGCAAATCGTGGACTCTCGTCTTCATTTACCTCGTTT
CATCTCTGCATAGTCTTAGTAATAAAAAGAATCGTTGGAGGAGCAGTGACCGTGGATCCATGAACTTTGCTGTTTTGTAGTAGAATTTGCACTGCATGAC
ATGATGAGTCAGATACTAACATGAGCCTAAACTGCTCATCGTTCCTTTTCCACCGAGTCAAAACGGATTCACTCCATCGAGCGAACGTGTTGGTGACAAA
CGGACGAGTAT