Description :
From Genome Similarity Track
Location :
contig_21:1373- 6247
Transcript NameFunction/comments
g3829.t1hypothetical protein

Sequence
4874 bases(100 bases per row)
GCTACTTCGATACCCCGGAATGAGTGGATCCCAGGGATTACTCTCATGCGTATCGCCCAGCAGCTGATGTCGCCCCGTGGGACGTGCGATACGTTCGCCG
TGTCTGCGTCCTGGAGATGGACTTGGATCTCCTTACCACCATTTCTGTCGCCCCCGGAACTGGCTGATTCCTGTTCGCACTACTCACTCTCGCACTTGGC
GGTCGGATTTGATCACCACCGCCCAAGTGCAGGCGTTGTATGCAACCCGCCCCTGGGAGATTTCGACACCATGATCGCCCCAATTTCTTTCAGCCTCTCG
GATGGTTCGCGCCTATGGCTCAGCAGTATCAGGACCTCATCCATGAGCATTCCCAGGCTGTGTGGGAGGCTCTCCATCACTTCACGATCAGCGCTGATCG
TCGTGCGCGAGAGACTTACCTCGAGACTTTAGCTGCTGAGCGCAAGCAGCGTCAGTCACGTTTCGGTGCTCGGCTGAAGGTCTTTCTCCGCGTCATACTA
CGTGGGTTGTAGAAAGACGGTGTGACCTTGACATCTTGTTGGATCCATTCTTCGTGTACCGGCCCAGAACCGGTGAGGAGAAGGTATGGTATCCTGGCCA
CGGTATTTCTCCCAGGTTTACCGACTTGATCGCCATCACCCCGCGACGACATTGCTGAACCATGGCGTATACAGCACCGATCGCCATCCGGCGCATCCGG
CATATGGAATCGGGCGTTTGGTCGGTAAGTTCACCCCCTTGGCCTCCTGTGATCGTGTAGGTCGAACTTCATAACTTCGTAGCATCACTGTCTCCTTCTT
CCTATCTCGTCTTCGTGGGGCCGACCACAGATGATCCTCTTGCTTAATACTCATTTAATCCACATAAACCCTTCCACCACCGCGTGCAAACCGTCTTGCA
CCCGTATCCACCTCTAATCAGCAGCATTTGCTACTGATCGTTCTCCGCCACTCGTGTGATTGCATCACCCCGAAAAAACTGCGGCTAGTGCGATTCCGCT
CGAACTCATATAGCAGTGCCCCGCAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTATTCTCGATGGACTCG
CCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATCGTTATCACCCAACATTCTCCCAGCTATCTTCTGGTAGAAGTGCT
TCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAACTCTTCACCTTCTTCAACTTGGAGACGTGCACGATCGG
AAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATGCCACATATGCGCAAGCTTC
CGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGTCTCACGCCTTCGTTGTGTTGATCGGCTCTAGC
TTGTATCGCGGCCTTGAGACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTCGCGGCTCGTGGTCAACCTCC
GCGTACTGCCGAGCGGCAACGACGCCTCTAACGTTGATCGTGGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACCGCGCACCCGATCGTGAGCGG
TGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATCTTCAAGGCGCGAGTGAGTGTCTGCACCAT
CCTCTCTGCCGTGCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGCGGAAGAAATCAGACATAAAC
CCGGGTTCCCGATCATGGCGGATTGCCTCACTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGTCTGTGCGGTCCGCGAAGCAC
TAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAGACGGTATATGGTCCATCGC
AATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCACAATCCAAACATTCCCCACGA
ATCTCTGGACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATTCGCTGGTACGTACGGCCGATCCCCTGGTGTCCGCCCTCCAAACTGGCATG
ATAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGCGTTATGTTCCCGCAATAGAAC
AACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAACGTCTCCTCTCAGGTAAGCCT
TCAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGTTGTACGATCGTCTCTTGCAGCGAAGCCGATACTTGGCG
TGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGCACTTCACCTAATCGGTTGATCGCGATCAGATCG
TCGATCTCCCCTTCGGCCGACACAATCGCCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGTTCCAGTCGCGTTTCACGTGGAG
TAGGTCGTGCGTCGGCCAGGCCTTCAGTGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTCGATCTCCCCTCTCATTTGTCGGA
TGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGACCGCGGTATTCGGCTTCATTCAC
CGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATGCTCCCGCGCTCCTCTTGACACGT
GCCGAGCCGTCGAAGCTTACGACCAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTGTCTGCTTCGGTTCCTTAACTGGGGCTATGG
CGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTGGTGCACTTCCTGATCTCCATCGT
CCATTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCGAGTATCTTGACAGAACTTTGATCGATCGGTT
GGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTAATTCAACTCGTTCGACTTCAACGTACGGCTC
GTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTCGCATATACGACGATCACCGGTTGGCGATCAG
AATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATGAATGCTGTCTTCGCACGGACCCAGCGGTCGTTCGCTTTGCCTGTTTGA
TCGGCATTTCCGATGCGATTTATCTCGTGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATACACCGCGAAGTCCTCGATGAACCGACTATAAT
AGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGACTCGAGATCTTTCGGCTTGGCCTCCAACCCTTC
CGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGATATCCCCAGAAACTTTTAACCACGCTGATCGACAAGTTCCACCGATCACAGGCGTCAAGCAGT
TTTTCTACTTTCTCGCAAACGTCGTCCCAAGAGCCGGCAGATCAGGATATCATCGATGTATGATCGACGCCCCAGCACTGAAGGTCTCGGTTCATCCTCG
GGTTCGCCTTCCTTGAACACGTCGACCAGCTTGGAGGATCAGCGTTTGGACTGATTCGGAAATGTCCATACAGCGCGTTGTCTATCAGTCGTTGGTAGAT
CTGTGGGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAAAGGCTGAGATCTTCCGAGCGCGTTCTGTCATTGAG
ACTACCCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAAAAGATCGTTGACCAAAGGCATGGGGTACACCATCA
GGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTTTCTTGATGATGATCACGATTGGTGATGCCCACGGCGATGTC
GAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTGCGGAGCTACACGTCTGACGCGTTGGGCCACAGGCG
TTGCTCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTGCCGATCAGCAAGTGACGGCGACGCCAGATGATTTG
CCGCAGGCGATCAATCTCTTTTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAGACCTCGTCGGTTGAGCTGGACACCTCGGGAAGG
ATTGCCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGTCCTCCGC