Description :
From Genome Similarity Track
Location :
Scaffold_2895:1373- 3989
Sequence
2616 bases(100 bases per row)
TCTTCACCGCGATGACCCTGAAACCCACAGTGGGCGATGACCATAAGTCGCATCAACAAATCTTCAGCTTCAGGTGGGATCCACAAGAGTCCGTCAACCA
TGATCATACCCTGTTCGCGTGTGTGTGGCGCCTCACAAGCCAAGCGCCGGTATTGCAATTGCGCGCGGCTCACAACATCCACTGTTGGCCAACTAAAGCN
NNNNNNNNNGAGCCGAGCGCCGGTACTGCAATTGCGCGCAGCTCACAACTTCCACTGTTGGCCAACTAAAGCCAGAGTCACTCAGTGGGCGGAGAGCCGA
TGGCACCACAGTCCAGCGCGTAGACACAGCGAGGACACGCACAGTGTCATCTTGGATTGCAGCTTGGCCCCAACGTGAGACTAAGTCGGCCCATACATTG
TTCTCGCCGTCGATGTGCTCGATCACATACGGGAGACCACAGAGGCGCATCGCCCAACGCTGCAACTTGTCACGGGTGTGGCGCTTGAGCTCGACGCTTG
GATCAAAGATGTGGATTAGGTTGGCATGGCCGCAATAGAGCCGGAACCCTTTCTCACGGAGCAGTAAGTATTCGAGATCCGCGCATGCCTTTACAATCGG
AAACGCCTCTTTCTCAACGACTGACCAATTCTTCTCGCTGCCTTTGAAGAGCCCGCCCTTGCAGACAACCAGCTGGTGGGCTTGAGCATGGACAGGAAAA
TCGGGCTTCCACTCGCGCACTTNNNNNNNNNNTATGATGCTCCAGCCCAATGAATCCATGAACATACAGAGCTCCGCCTGGTCGTCGGCAAAGAACTGGC
AGCTTGAGCAGCTCACCAAGCCGCACACTGCATTGAAGCACTCAAGCTCATCCGACACCCATGTAATTGCTGCTTGCAGCCCGTTCTTGTTGCGGCGACC
GAGAGCGCGCATGGCGGCCTCCAACTTCTCGTAGAGCACTGCAGACACCCTAGCATAGTCGAGTAGCGAATCCCTGAGCCAATTAACGGCGCATAGGAAC
TGCTGGAGGGCAGCAACGGTAGGTGGCGGCGGCAACTTGGACAGAGCCTCGATGCGTTCGGGGTCATGAGTGACGCCTTGACCGGAGACAACACGACCAC
ACCACAGCACCTCTGTCATGAACAGGACACTCTTCGACACGCTGAGCTTGAGGTTATGCTTCTCAACGAGGACAAAAAACCCGCGCAGTGCGGACAGAAA
CGAGGTCACATCTGGCGCGAACACAATGATGTCGTCGATCCAGATGAGACAATGGCGGTTGAGCAAAGGACGGAACACCACCTTGAGCTGATTCTGGAAA
TGCACGGCGGAGTCCATTGAGCCCTGGGGCGCCCGGGTTGGAGTGAACACTGTGTCTTCATTCATGAATGACATCTTCTATTGGGACTCCTCGCTGAGCN
NNNNNNNNNGGGGCACTCGGGTGGGGGTGAACACTGTGTCTTCGGTCATGAAGGACATCTTCTCTTGAGACTCTTCGTCGAGCAGCATCTGCCAAAAGCC
CTTCATCAGGTCGAACTTAGCAAACCCCACAGAACCCATGACCTGTGGGAGTGCGACTGCCAGGTTCGGCATCGTACCCACAATGGGCACGGTCACACTA
TTCACGGCGCGGTAGTCGATGGTCATGCGGAACTCGTTCGTGCCTGGTTCGCGCACTGGCACCGCCGGACTTGCCCACCTTGCCATGCTGTTGCGGCGGA
TGAGTCCATTCGCCTCGAGTAGTTGCGTGTACTCTTTGAGGAATGTACTCTGAAGCGGCGCATACTTGCGCTCGCGGCACTGGACAGGTGTCGCTCCATC
TTGTAGCGTCACGTGCAATGGTTCAACAAGCGCCGGGGGGTCGGGACCGAGGTTCTCACGGAAGCAGTCTTGGAACTCGAGGACGAGGAGACGCAGTCGC
TCAGCAGTCACCCTGTCTAAACTTCTAAGCTGTCGATTCTTCTCATTCTCTTCTTGAATGGCTTTCGTCTCAGCATCCGCCATCTCTTGCAGTTTGGCGA
AAGCCGAATCCATGATGTCGCGGAGCGTCTCGATCTTTTGCTTCTTTGCCTCGAATGGTGCGTTCTCGGGCGCGCCTCTCTTGCGGACTTGGTATCTTCT
CGCGGCCGAGATGGCCTGCACCAGGTGCATCGTGAACACCATACGCAATGACGTGGTGGAGATCCGCGTCGTCTGGGACGACGACACGACCTTCCTCACC
CGGTGAGACCTGATACAACAGGGGGCCGTCCCGGACGGAGTACCGATGCAATCGAGCCGCACACGCGGAGGTAATCCAGACTTGGATGTCGGCGAGTCGA
GAGCGCGGAGTACCACCGCACACTGTGCATCCGTACTGTACGCGTCACGGATTAAGTCGTACACATCCGACGTGACGTGAGCGACGTGAGATGATTCATC
TCATAGTCCGACGACGTGGCAGGGCGTCCGCAAGTACGTTGAGCCGACCTGGCTTGTACGCAACTATGAAGTTGTATTCTGAGAAGAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN