Description :
From Genome Similarity Track
Location :
Scaffold_1329:1373- 2471
Transcript NameFunction/comments
Phyag_g10295hypothetical protein

Sequence
1098 bases(100 bases per row)
CCGGGAAGTCTCGACGGAGCTGGTCCGAGTGGAGCCCCAGATGGACACCGAGCGACTACCAATACTGGACTATCacgctgaagatggagaagggGATTTA
TTGATGTCAGATTACGACGTCAACCTGCCTGACCGGACGTATGTCTTGCGTCTGCACATGGCTGGTCCCCGTCCCATCCGAAGTCCAAGTGGGTCGTCCA
ACGGAGAGCCCGCAAGCAAGCGGCCACAACATCGACCGCCCCAACTGGGGAGCTTGCTTGGCTCGCTGCCGTCCCAACCGCCGTCATTGGAGGCGTCCGC
TCGGGAAGACTCGTCGGGAGATGTAACTGCAGACTCTGTCCCGCAAGAGGTCGGCACTTCTGGTGAGTCGTCCTACGGTGCGACGTCTGGATCCTTCGCG
TCCAGGAACAGCTCGTcggcgtcctcctcgtcgacaCTTGACCCTGGTGCCACAACGCACATGCCGTACGTCGGGCATGCCCCGATAGTGATGAGCGCTC
AGGCCGTGCCGGGTGTTCCAGTCGGAGGTGGTACAATGGGTTTCAGCGTGACGAAGGTGATCCCCAAGCGGGAGATCCTACCGGAACAAAACGACGTCGA
GGTGGGGGAAGCCGAAGAGACAGCCGTCAGCGTGAAGATGTCCAGGACCCGATCGTCGCGGAGATCCCAGAAGTATCGTGGCTCCAGCCGAAGTTCGTCG
AGCGAGTATGACTCAAGCGAGGATGAACGCCGGCGCCGTCGCCGCTCCCACCGTCACTGACGCGAGTCCAGGAAGCCGTCGCGGGACCGCTCCCCGTCGA
GACGCTCCAGCCGGTCGAGGCGTTCGTACACGTCTGGCAGATCCGGCCGGTCGGAGAAGTCGAGCCAGTCGGGCCCCGCCGAAGTCACCGTGAGCATATT
TCATGCCGTCCAGCAGGTCTTGAGCCGGTTAGATGAGAGGGGTCCAACGGAGAAGTCCTCAGCCCGGTAAGTAGCCATCCGgcgcgagctggaggaagtC
CGACGGGACGCGCGGAAAGCCGAACAGCGAGCTCAGGATGCAGAGCGCCGGTTGAACGAGGTGCCGGTCCGGCTGTCGATGAAGCAGGAGCCCGAGGA