Description :
From Genome Similarity Track
Location :
Scaffold_60:137283- 142693
Sequence
5410 bases(100 bases per row)
CAACTACTGCTAGGATTACTGTTTCAACGTGAGGTTCAACGAGAGGTTTAACTAAAGGTGCTGTTTTAAGCACATTTAAAAACCTTATTGATTACACATT
TAACGTTCATTTTGTTCTGGCGAAACTACTTTTTATCCCTAAACCACCACGAAAAATTCAGCTCAGGACAGTGGAGATCACCACCACCACTTTGTGCTTG
GGATCGCCGTCAGCGACGCCGCCACAGATCTTTCTCTCACCGAGCCGGGGAATTTCACCAAAGACAAATTCGTGGCTCGATGAATTCAGCTTTGGCGTGC
TGTGGCCTTGTTCACGGCAGTACTTGCAATGTGTGTGATGATTGTGATGTCCCTTCATGGAGTCTAGGTGTTCTTGGGCAGCTGTACTGTTATTCTTCAT
AATCAGCGTGACTGGGTATATCCTGCCGTTCTTGTTTCTCACGTTAGAGTAATCGGCGTTTACTAAGCTTCCAAATGAGGTGCAATTGGATCATTACGTG
CACATGCAGCAAAAGAGTGAGATATTTCAAGCGCAAGTGAGCAAGGCCTGACAAACGATAAAGCAGACTGGTCACGGCATGCTCTTTTTGGCACCACATC
TTTGTATTTATGTCGAAGAAATGCAGCATCTTGTAGACGAACAAGAGCTCTTAGTTCATGTATTACTACCGAGTTCCACCAGCGATAGAAACTGCAGCAT
GTCCACGCTTGTGACGAAACCATACGATTATACCCCATAATAGACTACATAATGGAAGCAGTGACAGAAATAAGCTATCAAACAGCTAGCCGCAGTCCAT
TTCGCATCAATCTTCAGTCACTTTGACAAATGTTATCGTTGTCACAAAATAACACGGTTGTGAAAATATTTCCCCCCGATAGCTGCATACAAGCACGCAC
GACAAATGCGCAGAGGCGTCGGTGCATCTGGAATTTTGCGCTGAATAATACAGCTATAAAATCAATAAATCGACCAAAGATCACAACGTCAGCAGCCACC
TATAATGCTTCCTTCTGCGATTACGAGATACAGCATTTAATCATTAAAATTTGTCATTTGTTGAAAGTATCTTTTGTGGGCTAAATCCGGGCTGGGACAA
CAACAAAAACTTTAAGAGCTCGCTGACATGCGCATAGGTCCAAAAATACATAATCCCTATCTTATAACTGATCAAGCACGCTTCAAGTAGCGAGAACGCT
TTATTGCTCAACTATTAGTTAAAATCCAAAGTACCTAGGGGGTTACTTTAGGTCAACTAAAGGTTCAACAATGTTTCAATTACCTTTATAAACGCGCTCT
AATACCATGTTAATCACCTGAAATTTGGAAGCTAAAATGGGCTCTAAAATTTGCACAAAATGCTTCAGAAATGGCTCCTTACGCTGGTAGTGCTTTGTCA
TAAATACGATCCAAACCCGTTATAATCCATAAACTAATGGAACAGAGTAGTATATTTTACTAGGGCATGTGCGTACATGCGCTATGGTAAGTCGGTATGG
ACAACCTTGTCTGTAATCAAGCGATCCCGCAACTTTTAGATCCGACAGTTTTCATCAAGTTACCTATATATTCCTCATATGTTTCCGCCAACTCCTTCAT
ACATAGCCAAATTTTGTACCCGAAATAAGATTGGATAGCAAGATCGGAGCTCGCCCCATGATATATATATTTTAGTCCATAGAACTGAATCAAGTTCTTT
ATAGTCACGTACCTTGCGCTCAATCACTCATAGCTTCACTTCGAGCTCGCAATAATGCATATAGGCACTCTTAGACACCTCTCTCAGACCAGCGCGTCGT
CGACAATTCTTTGGTGAATCGTCAACGCTGTTGGATGATGCATCACCGTGCCGATGTCTCTTTCGCTCGTCTGTACTACTATTGACGACTGATATGGTAT
CAACAATGTGCTCTTTCGATTCATTAAGTGTGCTTTGAGCACTAAGTACATCTCCGAACGTGGCTAGACTAATGCGACTACTTGCACTTATAGAATCCAT
TTCGAGATCATCATATTCCGAACCCTTTGTAATGCATGATTTTTACTAATCATAAGAATCACTTGACGTTTCATCAAGACATTTATCGAGATCTGGACCA
CTAGATTCGTTGTTATCAGGCGTGGTCTGTTAATTTAACCAATTTCCTTCCAACGTTTTGCCAATGATAACACCGTGAAATCCCCCATGACTAATGCATC
AATCCTAGTCGCTACGTCTCTTTCAGAACGGAATCCAAGGGTTCATTATCATCTACTGGATAATATAGCGCTACGAGCTTCTTTATTGTTGCTTTCCTGA
GTGTTGAAACGAAGGTTTTCGAGCAGACGCACATATCCGCTGCAGTGTTGACGATTACGGTACACTATAGACTCAACGATGTCCACTTCAGCTGCCAATT
TCTTGGTATTTTGTTGCAGGTAGTAATTTTTCTGATCCACTTAATCGCCGTTAAGTCCGAGTAGAAATCCATGTTTTTGCATTGTCCTTATGCCTTGGCC
TTTCTAAGCCCTGCGGTACATGAACATACGGAGATACTAAAAAAATGGACTTGATAGAGATCCGGTTTGACACCAAACATGCGCTCATGTGGTGTGCTAT
TTGCCGTCTTATTAAAGACTCATTTTTTTAGGTATACAGCATAAATCCGAAGGAATCGGACCATAAATTGGGTGAGAAACCAGATTCTCGATGCATTGTC
TTTGTCATATCATTTAACGATTGGTGCTATCTCTCCAATGGATTAATGAGAGTGTTTTTAAGCCCTACTTCTACATGCTCAATTCCACGTGCTTCATACT
ACTTGTCAATTTCGCAGTTGACAAACTCACCACCTTTATCCGTAAGAGCTCGTTTTCCGGGTAAAGTACGGTATCCTATCATTATGGTCCCATTGACGAT
GACCAAACTTCTGGGTGCTACGCCACCCTAGCGCTCGGCCCAATTAATATAGTTTTGTTAATGGGTTTACTGTCACGGCGTTCTTGTTTGTTCGAAGGTG
AACTGTCAAGTATCGCTAATATCCATTCATAAATACGAGGGTCGCTGCAAACTTGGTGCCATTAATGATGACCACGACTACCATTTCATAATTTATAGCT
GGCGTAAAACTAGACTATAATTGACGGCTTAGTAGGTATCCTGATTTTAAGCCTGGTACGGTCAGCGAACTGATTGCACTTGCATTATCAACGATCAATC
TAACTGCAGTAGCAACATTGACAGCTACTGTTTCTATACCGTGGAGTAGTTCCATCGAATAGAACTAGTACCTATCAATGTTGCTATTGAAGTCGTAATA
GCAAATCGATTCCGTAAAGACACATACGAGTAGACGAAATTCTTGTAATCGCGTCGAGAGATATACATAAAACGATGAATTTACACATAAATACGTTAGT
TTCTACATAGATCGACATCAACTACAAGATTTGTGTATTTAACTGTGCTGAATTTTATTAATGATCACTACCACGACCGCGTCCTAGCACAACTGGATCC
TGAAAAGTGTCGGTTTGACACAGAACATGCTCAAAAGAATAGCGGCGGCATATACAGAAGAGTTCTCTGGTCTTAAACTTACTCTGTATTCGTTAGAAAT
GTACTACTAATTTATTAGAACCTGTATAAATGGAATCTGCGTAAAATAATAATCTCCGTTATCTAATACGATGGCTTGGTTCCGACTCGGTACGTATGTT
ATTTTGATAAACCTATACTATTCAGTTATTAATTCAGAAGACCAGTCCCGACCACTCACATTGCACCCAAATATAAAGTGGGGCGGGCTGCGGATGCCGA
CAATACGTGTTGCTTTACCAGGCCCCCGCCTCCGCTACATCACCCCGTGTACAAGGGCCAGTAAATATTGCCAACAAGACGGCATAGTACGATAAATGGA
TCTTCTAACGGGGTCCTAGATGGGCATTCTGTCGCATGGATGCGCACGACTGGACTGCCGATTTCCGTCTCACGCAGTTTAAATTCCTCGATTTCAACAG
TAACTTTGGCGTGTCATTTTTGTACATTTAAGAATGTGGTGGGCAGATGCTAACTTTGAAGGTTTTGTATTGAATATCAGACTTTGTGGTAAGCTCATTC
AAGAGAAAGAAGTGGATCATAGTGTCTATGATAATTATCACACATGGTTTGATGGCAGAAATATGTTCATTGGCACCGCATACGTCATCATGGGTGCGCT
CTGCAAGGGGCTGACCATCTTGTTCTTTGTCAAAGCCCAAGCTCAGTCCACGTAATCTGGGCGACACGCGGTACTTGATCTGGAAGAATATACTAAACAA
CAACAGGGTCCAAGCACATGTCCATGGAGCCTTGTTTGCGTGTAGAAATTATCTACGTCAAGAAAATACCACTGTGCGCTCACCGTCTTACCATTGTATT
CGTTTTCCTAACTTTCTAGCAAAAATGTCATCTAAGCTCTTGTCACAGAGGACGCAAGAATAAAAAATTCACTTTGATGCTCAAATGTTATTACAACAAT
CAAAGTGTATCATCACGGCTGAAGAAGTGGCGAATATCCTGCTGAACCGTCTGATTGGCACGAATATGTCAATCTTGTCCCTCATCCGGTGCAGAGTACA
AATGAATTCCTGGAGTCTTCATCTTGTTGCATCTAGAACGTTTCAAGTGTTTGGAGTATTTTCTGTGCATTGGCAGGGATTATCTTGGGATGCTCTTGGC
TGTCGTCATCTCCTTCGGCAGCTTCCTCTGTGGCGGTGTTGCTTGATTTTGCCCGGTGGTTGACGACATCATTTATATTCGGTATATAAGCCACCACTTA
CTCAGCGGGGTAGTTGAGAAGGTTGTGGATGTCCATGGATCTCGATAATGAAACAGGCGAATATGGGATATCAGTTGTTCCGAGAGGCGTTATTCATGTG
TGGCGAAGTCGATGTCATAAAATTGCTGATGTGAGTCTTAATATTCCACTTGACCAGACATCCCTGACTTACGGAAGGGGTACTCCGATCCGTGCCTTAT
TGTATATCCTTGTGCTTACCTTGTGTACCCGTCGGTTGGGGTGGCTTGAGCTATTCGTCATGGCCTTGGGAGATGTCGATCTCGCTGAGGGGATGGGATA
GAGGTTGATCACTACTTAAAAATGTTCACACAGCGATCGGGATGTTCGTGTATCGATCTCACTTGAGATCGATCCGATCTGACTTATAATCTCTTATTCT
GGTCGCAGACGATTGATCCCGCTTGATCTCATCTCTTGTTCTCTAGCGCTTGGGCTCACCTATAGATCGCTTCGAGATTTTCGGATCAGACTGTGCCAGA
TCACCTCGTCGATCTTGGTCACGTAGTCCTTTTCTTTGTTGCTGCGTCCAATCGCAGTGGTCTTGTCTTAAGAAATTGCGCGATCTGGGCCAAACAATCC
GAGATTGGTC