Description :
From Genome Similarity Track
Location :
Scaffold_166:13725- 16425
Transcript NameFunction/comments
Phymu_g5893HECT E3 ubiquitin ligase, putative
Phymu_g5894hypothetical protein

Sequence
2700 bases(100 bases per row)
AACAGCGCTAAACGGAAGAGCTGTCTGATGTGCGGCACCAGCATCGGGTTCCTCATGACCGGTGAGCTCGGGCGCCGCAAGAGCTCCCGTATGTTATTGC
GCAACAATAGTCGAGGCATCATCGGTGCTGACTTGGCCGGTGGTGCcggagaagaggaagatatCGAGGCTTTGCGATCTCGACAGCGGGCGTTGTTCAA
GCGCCGTATGAATATGATGGCGGCCAGGAAAAACCTGTCTCAAAGACAACGGGGAGCATTTCGACGACGCCTTTGGCAACGGAAACAGCTATCAGACGGA
AAATTCCACTGGGTACGACAGAACAGCACCGATGTGGTAGATCCAGTGCCTGAGGGGCGGACTGGAGATGCGGTACAACCCGTATTGCCATCATCGGAAG
CTTCATCGTTGGCTGGGCCGAACGGGGAGCGCGTCACAGATTACCATAACTTCCGCTCGCAGGGCTTCGTGTCGATGTATGATGCTTCCGGGCGATTAAC
GTGGACCAAGGCAGATGAAGTGTCCATTGACATGGAATCGTTCGACAAGATTCGCAATggtctggagcagctggactTTGAGGTGGGTAATTGCAACAGC
TTTCATTTACTACTCTTACACTAACATCTTTGGTTGATTGTAGGGAGTGATGGCTCTTGGGTTccgcatgaagaagcagtggTTCTTGGTACAGTTGTCG
CGAATTGCAACTCCCGTgactgaagctgttgctaAACTGAGTACGTTTACAGCATAGTTGTCATTTTGGCTTTTCGCAACCTAACTTGTGGCATCAATTG
CCTTGATACGCAGCGGTGACGAGAGAGCGAATCATTCAacagtcgctgcagcttgccgAGGCTGCACCTGATGCGCTTCACGCGTATCTGAAGATTACTT
TCGAGGGCGAACCAGGCATTGACGCGGGAGGTTTGCTTCGCGAGTGGTTTGGAATCGTCTGCAAGCAGATTTTTAGTGAGAAAATGGGTCTCTTTATCCC
GACGAAGGGCGAGGATATGAGCTACTGGATTGATCCGCTCTctggcgagaagaacgacaGCCACTTGAAGTTGTTCCGTCTTGCTGGCATTTTGATCGGC
AAGGCGCTTTTTGAGGGCCTCGTGCTTGACGTGCACTTGGCTCTGCCATTACTGAAGCACGTGTTGGGTATCCCCATCTCGTTCTCCGACCTTGAGTTCC
TTGACGAAGAGCTACACCGGAACTGCAAGTGGCTTCGCAACAACAATCACGTAGAGGCCCTTTGCCTGACGTTTAGTGTGATGCTTGAAAACGGCACGGA
AGTGGATCTGAAGGAAAATGGACGCAACATCGATGTTACGGACGAAAACAAAGAGGAGTACCTACGACTGATTCTTGAACACCGCATGCTTGACAGCATT
GCTGATCAGTTGCAGGAATTCCTCATGGGAATTTACGATGTGGTGCCAAAGGCTCTGCTCTCCGTCTTCGACTAccaagagcttgagcttATTCTCTGTG
GCATTCCCACTATCGACACGGCGGACTGGCGGTTAAACACTCATGTGCGCTACATCAAGCCGGACGAAAACAAGAAAGCCAAAAtcaccgaagaagagca
gaatGGAGTACTGGAGTGGTTTTGGATTGTTGTTGAGGGCCTCGCACCAGAGGAGCGAGCGAAGCTCCTGCAATTCGTTACTGGCACCAGTCGCGTACCC
GTGGAGGGATTCCGTGGTCTTATGAGCTCGAGCGGCATCATCCACCAGTTCACCATTCAGATCGTGCCACGAGGCAAGGAGAAATCCGACCTGTTTCCAA
AGGCGCACACCTGCTTCAACAGACTCGACTTGCCCATGTACCGcgacatggaggagctcgagacATACTTGACGATGGTGTCTCAAATGGAggtcttcgg
cttcggcctCGAATAGGGCATATTCAAGAAGTAATCCAGCTCAATATATATAACAACAGCCTGTGAGGAGTAGCGAGCTGTACATTCTGGGACCAATTCA
AATCGTCTTCCTTTCAGCTGTAAAACGTCCCTGTGAACACGTACATTATTTAggctgctccttctgcttggcaaTGTACGCTGCgacgtcctgctgcagc
atttcctgGTGGCGCTTGTCTCTGCGTCCCTGTGTACCGTCCGATGATGAACTGAGCCAGCTCGCCGAGGGTTCCTCCTGTAGCTCTTCAGGCTGCTCCT
TGGACTTAAGCAGAGCCAACGCTGCTTCGATCTTGCTCtcacttggagctggttcCACCTTTGACGTCTGTGTTTTTCCCTTACCCGCCTTattttcagc
agcagcagccaccttGGCTGTTTTCTCTCGACTGGCAATagcctcctcttccagtcGTCGGAGCCGATCACGCATCTCCTGGATCGCACCAGCCAGCACC
AGATCCTTGCTCTCTCGCTCGTGGATGACGCTCAGTTCGTTTTCTACCTGCTCCAAGCGTAGTTCCTCGTTCTCCCGTTCCATACGTCGCTTCACTgagt
acaagtacaaccCCAGCAGTGTCCCAGGACCAAAGGCAAAGAGTCCGTAGAAAAGCTTACGCTTTGGAGACAACAGATCCCTATTCCGTCACATGAAAAC
ATCACAACTGTAAGGCACACTATATCTAGACATACACGTGTGGTAACCGTGGCTTTACGCACTCGAGCGCGCCTGGAGGAGCGTCCGAGAAGAGCATCTT