Description :
From Genome Similarity Track
Location :
scaffold_27:137225- 143787
Transcript NameFunction/comments
Plaha_PHALS_09397sugar phosphate

Sequence
6562 bases(100 bases per row)
CATAAAGCGAAGGCTCCTATCGATCGCCAAGATTAATGACCATGCTAATAGAGAGAAGAAATGATTTTTTACTCCCGAGCTGCCCCGTACTCGCGCTTGC
GGCATTACAATCAGCCACGTCTTCTTGTGGTAATCAAATCGCCACGCCTTGCGGGCGTTTTTTTTCCGGCTAAGAGCTTTGAATGGTTAAACCCCCACGC
AAAAGTACCCGATCATTCTCTAGCAAGGGAACGTCGAACTTCAGTAGGCACAAAGGACCGGCTCTGAAAGAACTGGACTTTATTATACCCCGTGGAGGTT
GTGTTTGATGGAAACAAGCCATAAAGAAGCAAATTGTTCCCAGAGAGGTTGGTCTCAATGATAAATAAAATTGACTGTCAACATCAGCATCATAGGATTT
TACAGGCACGAAATCTCGCTCTGATAATCTCAAAAGCATCGTGCAATTACGTTTATCAAAAGTTTATAGAATGCAGAGGTATTGATAGCGCTAATTCTGG
GACAGCATCAGCGCGCCTTGCAAGCAATGTTTGAAGATTTGAGTGTGTGATACTTCAGCCTTTTCCACGTCAGAAAATCGTTATTATCTTAGATGTGGCG
TTGTCTTGAGCGTCGTAAGCCATGGGTTGACTAAAAACCATGCAGTTCTTACTTGAAGGGTCTACTTCGGTATACACTTTATATGCGCTTGGTATATATG
TCAGGTATGACAAatgtttttaaaaaaaattcaacaCAAATGTGATTAATGGACAATTTTGTATGTTCGTGCCATTTTCAAAGACAGCACAAGCTTCGAC
GCATAATTGCTGGTGGTATGTGGGTTACAGCAGCTATGCTTTACTCCTTGGATTAGGAGAGTTGGGTAATATCCATGCACTTAGCTATTGTACGATACTA
TGGGGGCTTAATGGCCTTATCCAATCAAGTGGCAATGTTTCAGTAATGGGCAAGTGGTTTAACGAAAACGAACGAGGTGCAGTACTTGGAATCTGGAGTG
GAAATGGATGTCTTGGTAACACTGTCGTTACGGTCGTTGTCGCTTCAATGTTTGCATTGGTCGAGAAAGCATTAGCATGGAAAATAGCTCTTGTGGTAGC
AGCTGGACTGGACTCAAAGGATGTAGCGTATCGCTATGAGCGATCAGAAGACGCCAAACCAGATGTAGCCATCCACAAAGATCAGACTGAATTAATGTAG
AAGTTGGAAAAGCTGATGGTGCATCCCTGGAGTGAGGATTTGTGCTAAGTCGTTTTAGCAATCGAAAGTGTTGGTATGTGCTTGTCTTTGTCATCAAGTT
TTTCCATACGCAATGACATCTGTTTGTGTTAGGTCAGTCAACTACGCATTGTTCGTTTGGCTTCCGTTTTATCTAACAGTCTCACTCCACATGGACAGCT
CACAAGCTGGTACTTTTTCGGTATGTTTCTAGCGTAATTGCCAAGATAACAAGTATAGTCTTAAATTAAATGTAAACATGATTtatagatgctcttcgat
aTTAATCAATTCTTGGTGATTTATCAGCGGATTAGTCTCGGACAGAATGAGCCTATAGTGGTAACGATGTTGCTCTTCTCTTGGTACGTCATTGAACAAA
TTGAAGTATTATTACAATGTATTACGCTATACTTTATGGATGGTGCATCTTATCATGCGACAGCGTTACTATTGCTCACATCAGGATTTATGCTCGGTGG
CCCTGCAACTCTAATCAGTACAGCTATTTCAGCTGATCTTGGCACTCACAAGAGTATCAAAGGGAATGCGAAAGCTTTATCGACTGATAAGTCAGCAGTG
TTGTGTTAAGTGCACTCCGTGAGGATCGTTGAACCCGACTGAGTTGTGGTGAGTATTGTTATTCACTCGTGAGCGAAATAACAGGGATAGTTAGTACTAG
GGCAGATAATTAATGCCCGACTCACTGCTCTCAGCAGAATCTCTTATAGGGCTGAATAAACTATCTGTACCAAATATTACAAGACAATGAGGATATCGAG
GGATGTGGTTGTTACCTGTAAAGAAGCTAAGCGCATCATCTATCATGGATGAGACTGTTATCGAGAATACTCGTAGATCACATAGTGCGAAAATAAGACG
GGCATATGGGgatgaaaagctttcacgTCGTTCTAAGAAGAGCTTCATCACAAGTGCTGTCATTAAAGCGAGGGGTGCATCATGAGTTTGAATTGGGGTT
GTCGTAATCAAGGAAACAGGGGGGGGTGCTATTGGCACTTTATCCCATGCAAGTAACAATGACGGTGTTAGGGATAAAAAGTAAATCTTTATTCAGCACT
TACTTTTTGTTTTGGTCAGTCAACGACAAAAAGCAAATTGTGCGTGCTGAAAGTAACGTCAATGCCGCCACTATTTCAGCGCGGAAGTAAATCTTCAAGA
AGAAAGTTCTGTCGATGAGCATGGTCGGCTGCACTTTCTCGGTGTATATACTCGTTATGGGTATCTCCAGCCGCTCATGAAAGCGAGCAATATCTCGTCA
CTATGGTGTCGACTTACAATCGGATACTCGGAAGGTTCTGATTACTTGACATGCAACATCGAGGCCCAATCGACTGATTACATCAGCTAATCGTGTCACA
TCAAGACTATGCACAAATTTCATTTGACGACACATTTGTTTATACGTTCACGAATGCAGCTGTGAGAAGCATATCAAATCCTTGTGAGCAATGTTCAAGT
GCATGTGCTGCAATAATCCACATGCTAGTGTAGACAAATGTGATTTTAGCGCCGACATCATCCCGGTGCAATTTACGTGGGGGCTGAGCACAGTGAGCAC
GTTTTGGGCTGGCTGCGTCTCGTCGAGTGAGAATTGAAGAATTTCACCTGAGCACGAAACTTTTTCGGTGTGGCTTAACTGGAGAATACCTCTGCACCGT
TACCACGATTTACTTTCCAATCATCATTTGTGAAGGTCGCAACCTTTTGCGAGGACTGGTTCAGGGGCACGGGAGGGAATTTCTGGCAAATATATGGCTC
GATGAGCTAGGCTTGATAAGGTATGAAGAGTGGAGCAAAGCCTCATGCACAATAGCCTCCCCATAAGTTGTCACTTCTGCGCAATGTGTGAAAAGACAAA
ACTGTGTGAACCCTCACAGTTGTCCGCTCTTAGTTAATaaaaatgtaacggggtaagcACTGTAATCTCGTGCTCTTATGCATTCATATTTGTCAACAAG
CACACAAATAGCAATATCTGCGAGAATGGTAGAGGCCCGAATAGAATAGGTCCGTGTTGTACGTGGGCAGCTTGCCGCACGCCAAAAAAATGGAGACAGT
TTCATTGTTAGAGCCAGTAAATGTATACAGCAAGAACTAGACAAGAGAGCATTAATCTAATATATATAATGTATAATATATTCTTGAAATAGCTGATACC
TAGCTATTTTATTGATCTCGGATCTGCTTCCGATAAGAGCGCACAATCCTAACTTTTGCGCGTTTGTTTACATGGTCTCTAAGAATCAGAAGTTCCTCTA
CGGTAAGTGCGCGGCAATGGCGTTGCAATGGGGCTCCTTGGAGAAATGTTTTGCGCGACATGTGAGCTGTAAGCCTGACGGCATATTTGATTTATCTAGT
TGGTAATCAAACATGGTACAATAGATGGCTGcggtgcactttgcacagaaaaagcaTGGCCTGGAACAGTCCTCATGTGAGAACACACAAAGGTGAGTAC
CTGCAGTCCAACCCATAGCGTCGTCAAGAGCCCTTGCCGTGATTAAGTCGGTAAGTTACTTCGTTATTTGAAGCGTGATAAATATATAGGACTGATTATA
TCTATACTAAAACATGATATGTATAAACTGCTATATCTCATAATATGGTTGTTTTTAGTTTTTGACGAGTGGTTGATATCTTTCGTGTACCAGGGACCTC
TTCCTTACGGAGTCTTGTCATTTTTATAGATGCCGATACATCGGTAAATGAGTGTAATAGCAATTGTGTAAAGATGCAACGTGAAACCCATAAATTTATG
CTATATTGTCTCTTGCACATAATTACAAAACGGAATGGTGTATGTTTTTATCCTGTTGCACCCTCCCTCACATCCCCCCCAAGATGATGTGAGCTATACG
AGAGCTTGCAATACTTTTGTCATTTTAAGACACGGCACAAAAGGCAAGCTATCATTGCGCTTGGAATCGAGCTTCCGACTTTGAACTTTGCTGAGCTTAC
TACTTTCAGCATATGTACCGGACGCTTTCTCATGTGTGAGAAAGCGCGAGATAGCTCCAAAACAGGCGCGATCCTCACCTCCGGCGCTCTCAAGGCAATA
CTTCGTGAGGAGCTCGAAGTGTTCTTCGATAAGCACGATGCAGCGACTCACCGACTTCGAGCCAACTACCATCGCAGTCACTAAAAAAGACATGTTCAGG
TATTCATCGAAGGAGGGCTTGTCGTGCTAAACATGGTCCTCTTCATCTCTGTACAAGTCACGAGCTTTATACTCTCTTTTATGGCTGGCAATATTCCGAT
GTCTTGCCGTGGAGCTCACCGCAATGTTAGGCCCAAtaccaagtcggcacgactctTGCCTATGTTATCCAGGTATACTTATGGTCTAAACAGTCTCAAG
TCGCTTGCCGCGTTACCGGCACTGAGGTCGGGATAATCACCGTAACTGTCTCTGATGATCTATTGGGGCTGTGGCGGCCGCCGCCTTTTTCCGAGTTGCT
CAGCAGGCGTCAAAATCGATACGGGCTAGATGTAGGAAATGATCTCTGATAAATTACTTCACACAGGTTTGCTTGAGAGGGCATCAGTGGTTTAAATCTG
CGTCGCAGCTTTAGAGCAGCGGGTAACAGTGACAGTTGATGGTGAAGAAACTGCTCTGTCGACATTAGAGCTTTTGAAATCGGGGTCGTGGTACAGCTTT
AGTAAACCAACGGAGCGCAAAGGATGTtttcgcatccttttttGCGTATTAAGAGTATAACTTAATATCTTCTTCGCTGCGACCGTTAACATTTGATATA
GCGCGATAGCAACTTTTACATGATACCGCAGACATAACGGCACTTGCTCTTAGTGGTTTGGTATCTGTTTATATAATACGTCGTTCTACATAAAAACTTC
ATCACTCGGGCAAGATCATTCTGCGTCGTTGCTAAGTATACCTTTGGTATATTTTTGAGATGCGATATACGCCGGATCGGCTGATGGTTTTGTTGATTCT
CATTTTTGCCGCCCCGGATTGAATTGTCGCAATTCACGACCGTAACGTGATACATTCTAAATTTAATGAGAGCGTACTATCTTGCAAGTAGATCCTTGAC
AAGATCAAAGTTACACTTCTTCACAGCTCAAACTACAAGACTCGATCACAATCACGCAGATTTGCCCAATGGTATTTACAGGAATATAAGTGCAGCCTTT
TGCAAAGGCTGCGCTACAGACAACGGGAAATTGCTTATCTGGACTCGTAAGAGCCAGAATGGAGGTACGCATAAGGCTTTTGCTTCCAGATTTAAATTGC
ACCACCTTATCACACCCCAGCACATGTTGACATCATTTTAATTGAGTGGAAGGTATTATCTGGACATAGACAGCACGATCCATGTGCAAGTAGATGGCCA
GGTCAGGTTGCTTTTTTGGGTTATTTAAAACAGAGCTCCGGCCAAATTGCAACGACCGGCTTTTTTGCGGGATCTAACCGCTGGTGATATCTTCGATCAA
GtcaaattgaaaatgaaTCTTGTCAGTGCCATTGACACGCTTGTCTATATCAAAGTATAGCTCATTCAATGCATACTTCTAAGCACTGATCGCAAGTGTT
TAGTTTGGTTATCCACATCCAACTTCTCTTGCTCTGCGCGCCTATGttatcaaaattgatttctgcatagcaccgatttggCTCGCGCAGCTGTGACTCC
AGATAACTGTAGTTGCTAGCGCGTCAAAAAGTCCCTGTGATGTATTCAGCCATTTTTGGGGCCCCTATTTGGAATATTCGCTGCTGTGATAAAGAAATGT
CGCAGACATTATCAGTAGTTGATATTATTCACAAACCAGGTCAAAAATACCGAACTAAGTGCAGCCAAACATGCTGATCAGCACATCCTCCGTCAGAATT
GGCGTTTATGCCGGCATTTTGGCTAAACACGAGAATGTTTGATTTGCCACATGCAATTATCCTTTCTGTCGAAATTCATCTTCGGATGAGAAGTTTATTC
TCGTAcaaaagaaggcgtcaacgaCTCTATATTTTCCATTACTAAAAATTATCACCGTGAGACGCAATGTTTGGTTTTGAAGACCAAGTCAACTCCATGA
TGCATTTTCGTATCCGGCGGTAAATGCGTGGTTTTTTTCTTGCCACCACGTTGTGACCCTCCTTTGAAATACGAATGAATCTAATAAATTGTCGCTCCAT
TCTTCGCACTCAGTGCTCTGCGAGTGTATTCAGTTACAGATTCTTTAATGGCGCATACAAGCTTAATTCCTCCTCCGGTGCCAACCGCGCCGAATCGACG
GCCTCAGTGTCTtacaactacttgcacatatCCCCGAGGGATAATATGTCCGGCTTAATTAT