Description :
From Genome Similarity Track
Location :
contig_2:13722- 16047
Transcript NameFunction/comments
g535.t1hypothetical protein

Sequence
2325 bases(100 bases per row)
TTCTTCAGCCTCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGAT
AGAACCCGTCTCTCAGATCGAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGT
CGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCACCTGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGC
ACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGCCTTGCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACT
CAGTGTCTCGACGGGCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCAGTCCCTGACCGAGACTTGCGCAGCTTTGCTCGCTTG
CGCCGTTCACTTCTCGTGCGGAACCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTACTCACCGGCGGGTTTTACCC
GCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCTCTTCGTCGTGCAGTCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCA
ACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACCTGAACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACA
TTACCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGGTTCACATCTTCTCCCAACGA
CTCTCGCAGTCGTTGGCGTTCGTTTGGGGTGATCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGC
GCCGACAGGGCCATCCCTCTCTGTCGCGCTGCTGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGTA
CGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACTTCCTCGAAGTCAAGCCTTGGAAGGCT
CTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTG
TCATCTGGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCAATGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGC
GCCCCGCGCCTGCTGGTCCCTCTAGGTTTTTGATAGTCCGTGACGATATCCAGTATCACCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCG
CGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCCGTAGGTACATTGGTTTGGGACC
TCCCGATGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATT
GCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGA
TCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCACGCACGTCATACTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGA
TCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTAC
GCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACACAACCTTCGACAACGGGTCGACGATACGTCGAGTCGCAATGGCAGTGTCGACCTCGA
CAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCTACGTAACTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGT
TCGAGCAGTGGTTTCACGCTGTTCC