Description :
From Genome Similarity Track
Location :
Scaffold_1711:1372- 4318
Transcript NameFunction/comments
Phypl_g14012hypothetical protein

Sequence
2946 bases(100 bases per row)
CGCTTCCTCAAGCCAAGGTGTGTGTGACCCCCGTCANCTACTACATTCAAGTTCTCTTTGAGAATGGAAGACTCCGGGAGTCGGATGCCGTCTCGCCAAG
GCTTTCCTCATCGCTCTGATGACCACTGGACCACCCTGGAGAAGATGGTCAGCCTTCTAGGCGAATCGGCTTTCGCTGGATTCCCCTCGCTCCctgccga
gcagcagaggGCACGAGTGGAGCGTTTCGACAAGTACGAGTCGTCGCTCATTGCTCATgtcagcgctgcagcgcaggaagctgctcgcgtgACAGTGCGG
GCAGAAGCCCAGAGCGCAGCTCAGTCCGCTGTGCGGGACCCCGCTACGTTCGCTTCGCGACCAGGGTCGACGAAGGCGGTCAAGATGACGGTCCCCAAGT
TCGACGGCAAGGAATCGGACAGCCTGGTCTTCTGGATccgcgagatcgagatcgCGCTCAGCGCAGGACAGATCTATGATGCAAGATCCCAAGTCGCCTT
CGCTCTGTCCAATCTTGGAGGtcgagcgcgcgcgtggGCCATGGCCAGGGAGACGTCGTCTNGTCCAAAATTGGAGGTCGAGTGCGCGCGTGGGCCATGG
CCAGGGAGACGTCGTCTCCTGGCTTCTTCCACTCGTGGGCCTTCATGGAGCAAGAGCTCCGCAAGAATTTCTTGCTGGCCAATGTGGCCTACCGTCATCG
ATCtctcttcttgcgctgcaaGCAAGGCAAGCGTTCTCTTCAAGACTACGTCATGGAACTCCAGAACCTGGAAGCGGCAATGGCCGGGGCCCNGGAACTC
TTTCGTCGCCAAGCGAAGACGTTCAACGAAGCGGTACACATCGCCATGTTGGAAGACCACTGTGTATGCTCTGCGCAGTGTCACGCAGGACTCTCGGAAG
CCTCCTAGGGTTCCACTCCCATGGAGATTGCTTCGGCCGAATCGGCTCGCCCTCCTCGGAAGGtccgtggaggtggccgtTGTTTGGCTGCAACGAGCTG
GGTCACTTCCATCGCAACTGTCCGACGAACCCATGACGTGTGAATCGTGGCAAGGCCActacgacgtcgtcgtctctcAATGTGATTGAGTCCGATCTGT
CGGAAAACGGCGACTCCCAGTAGGCGTGAGACGCCCTACTGGGAGGCTTCGCTCCTCTCGGACGCAGATGGCTTTGCCATCTTCCCGTCCGCGGAAGCAA
GTCCCAGAGACGACACTTTTGTGTCTCTcggtggcggccacgaggTCTAACCTTGTAGTCGTTACCGCCAACGTCAAGGGGTACGAAGAACCTGTGACCA
TCCTGATCGATTCAGGTGCGTCGCATAATTTCGCAACGAAGGCCAGTGTGGCTAGGAACAGTGCATTGTATGCTAAAGCTTAAGAAGACTCTAAGAGTAA
TAGCAATGTGTCTGTTCGCTTGGCGACTGGTTCGATAGTATCGACGTGGAAGGTTATCCTCCCTTTGACGGTCAAGTTTTACGACTTTAAGTCCGTCTAA
CCATTCATTGTCCTTGACATACGACCTGATCCTCGGCATGCGGTGGCTTACCAAGCATGAACCGTGGATCGACTGGCACAGTCGTACCATAGGTGCTAGC
CATCATCCCCTCGCGGATCGAGTTTTGGCGGGTCATGTCCCCTCCTCATCTCGCGACGGATTTGTGCACGAGCAACGTGTGCCACCCGGGGAGCGACACT
TTGCCGGTACGGCAGAAGGAGTGCTCGTTCCAGAAACCACAGAcggtcgagcaggagctcccATGACGCAAGGCGTTCGGGCTGAGGCAGCTCACGTCGA
AGATGACGTTGACGGCGTTCGTCGCGTCTCCCAGGGTGGTCGAGCAGAGGCTCCCACAACGCCAGGCCTTCGAGCTGAGGCAGCTCACGCAGAAAGAGGC
GCTGACAGGGTTCGTCGCACTACGCAAGGTGGTCGAGCAGAGGCTCCCACAGAGCAAGGTATAAGGGCGACACGCTTGCAGGAAAGGCAGGATGACCCGT
CGGGTTCTACTCCAGCGactgtcgtcgtcgacgccgtcaccGGGAAGAGGTCTACGAGGACGGATCTCACCCCGACCCCGGGGGTGTCAGAACTattgga
gctcgaggagctcttctACGTCGAGTTTCTCGAATCGCTAAAGGTGGGAGAACTAGAGGACCTGGTCCTCATTCGCCGGGAGCAGACCTCAGTGGAACTG
AATAGCTCGTCGGTCATGGACCAAGAGGTGTAGGAGGAAGAAAGGGTCTATCATCGGCAGCAACGGTATGGCGCGACCATCTTAAAGGACCCTTCGGATC
AGTACTATCCGCTACTGCGGGAGTACGCGGATGTGGTCTCGGAGGACCCACCGTCAGTGGTGCCTCCGGATCGCGGTGTCCGACACGAGGTCGATCTGAA
ACCAGGTACCAAGTACTGCACAACGCGTCAATGACCGCTGCCGAAAGAACAAGTCGATGTGATCGATGCCTTCTTTGCGGCGAGCATGCCGCGGGCATGG
TGCGTGAGTCCAAGTCACCACACTCAGCTCCGACATTCTGTGTGCGGAAACCCAATGGGAAATTGCGCATGGTACACGCCTACGACAAGCTGAATGCAGC
CACGATCCCAGTGTCGACGCCAATCCCTCGAAAAGATGTGTTGCAAAACAACATGGCTGGGTGCATGGTCTACAGCGCGCTCGACATGGTCGACGGTTAC
TACCAACTGTTGATGCGCGAACCGGACATTCCACTCACAGCTGTGAGTACCCCCAGCGGTATGCTGTGGGAATGGTTAGTTATACCTCAGGGGCTCTCTA
ATGCGCCAGCAACGTTCAACCGGCTGGTGACCCAGCTCTTCCGACCGAGGCGTAAATTTGTACAGACCTACTTTGATGACATCTCCGTGCACAGCAGTGC
TGCGGAAAGTAAATCGGTCGATGAAGTGCATATGAGGCTCCGTCAA