Description :
From Genome Similarity Track
Location :
Scaffold_2840:1372- 3668
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_2840-abinit-gene-0.7WD domain-containing protein
Pytar_ATCC12531maker-par_contig_2840-snap-gene-0.4Replication factor C subunit 4
Pytar_ATCC12531maker-par_contig_2840-snap-gene-0.3Ferric reductase

Sequence
2296 bases(100 bases per row)
GACGACCACACAGTCCGCATCTGGTCGCAGTCTGGCGACGCCCAAAGCGACTGGAGCGAGCACGTCTTGCACACGTTTCGTAGTGCCGTGTACAGAATAA
GCTGGTCGCTTACGGGCTCTGTGCTAAGCGTTGCGGCCGGGGACGATGAAGTGACGTTCTGGAAGCAACGCCCCGACCACTTGTGGGCGCAGCTCTCGTC
GGTCACGGACCAAGGAGCCAAGGCCATGGCGTGATGCTCGCCTGATTACCATGACTGATTGCCGAAGAATAAAAGCTGAATAACAACATCGGTAGTTAAA
AGTCTTTCAGTGTGGTTATTCCAGTCTGTAACAAGCTCTCTCCTCTTTTTTTACGGTGAGTGGAACGTTCGCATGACGTACGACGTGACGTCGACGAGCT
GAAAGTGTTCGCTCGCGCCGTCCACAAGCTTCTTGTCGGCCTCGGCGATGCGCAGACACATTTTGGCCTTTTGAGTATCCGAGAGCTTGGCGTGGGCCAA
GATGTCGGCGTTGAGCTGCTCCAAGACCGTGACGACCGGGAAGCCCGCCATGAGAATATCTTCCACTTCATTCTTCATCTTGTCAAAGCTGTTGGAGGTC
ACTGCAGCCCAGAAAACCTCGAAAATCTCGGGCGGCGCCAGCTACGAACACACCCAATTAGAACTGGATCCACAACTTATAATTGAGGATAGGAGAGCGT
ACCCCTGCAACGGCTAGCACGTCGGCGCGCGTGATGGCGTCGTCTCCAGAGAGCTGCTTGGCACTCTGGAGCGTGTTGATAGCCTTGCGCATATCGCCGT
TCGAGCACTCGAGCAGCGTGTCGAGCACGTCGCCGGTTTGAGCGAGCATGACTTTTTCTTCCTGGCAAATGAACCGCACGCGGGCGGCCATGGAGCCCTT
CTCGAGCGGTGCAAACCGGAACTTGGCGCATCGCGACGCAATGGGCTCAATGATGCGGCTCACATAGTTACAAATGAGACAAAAGCGCGTGACCTTGGAA
TAGTTCTCCATCATGCGCCGCAGCGCCGACTGCGCATCCGTCGTCATCGAGTCGGCCTCGTCCAGCACAATGATCTTGAAGGGCGGCATGCCTGTATTGG
ATGCGTTGCTGATCGCACCCTGCGCAAAGCCCTTGACCTTTTCGCGCACGACCTTGATGCCGCGGTCGTCCGAGGCATTGAGCTCAAGAAAGCGACCGTT
CTTGCGGAAATCGGGGCCAAACAACTGGCGCGCGACCGCCACGATCGTCGAGGTCTTGCCCGTTCCGGGCGGTCCATAAAACAGCAAGTGCGGCAATTGG
CCGTTCTGGATCGACGTCTTGAGCGTCGCGACGACGTGGTCCTGGTGCGAGATCTCGTCGACGTTCTTTGGGCGGCTACAGAAAGAGACATTAGACACGG
GTGGCTGCATGCCAGCTCACGAAAATGGGGGCACGTACTATTTCTCTACCCACGGAAGCGCCGACGGAGCCACCTCTGTCGTGGCGCCATTAGATGCGGA
AGACGCGCCCTGGCGGCTGAACATGTTGCTTGGATCAGAGATGGAGCTGCTGGATGGAATGGAATGCCCGCGATTCCGTCTCCCGCCAAAACCGTCGCAT
TACCGATATCGATACCGGTATTTTCGAGTCACATCTTGCAAGCAAACACCGAGAGACTGGGAGCTGTGAGCGTTATAGCTCTTCATAGATCGATGATATC
AGCTCAACTGCAGATTGCAGCACTATAGGCTACAGTCCACGAAGTGACTGACACCTATCGTCCTCACGTACACCCACGGTGGGTGAAGCCACAGACTGTT
CTGGTGGATCTGCACCAAAATGGTCGGCATCGTGNNNNNNNNNNGGTACACCGGGTGAAGCCACAGACTATTCTGGTGGATCTCACCAAAATGGTCGGCA
TCGTGTGTATCCATGGAGTGGGTTCATGGGCACACGATTGTGGGTGAACGGGGTGGATTCTAGTATTTCGACGAATGAACGGTTCGCACCATCAGCTCTC
CTTATTTCTTTTTCTCTCTCTCTCTGAGTGATGGAGTCTCTTTCGTTTATGGAACTGGATGGTGGTGTCCTCCTCTCTCCCCGTTCACTCTTCAATCTTC
TTCCAGCCACCACGGCCCTCCGCGCCAAATTCTTCGCAGCAGAGATGCAGTCGGATATCGAGAGTTCGTCGGCCATCGACGACATCGGCTTGACAATCAC
AGACGAATGCTCGTTCCGCAGAATGCAATCGATCGAGTTTTTCCGGGACAACGACGGGGGAAGCCTAATGGATTCCAGGACGCGCATGCGGCGACT