Description :
From Genome Similarity Track
Location :
Scaffold_121:137168- 138867
Transcript NameFunction/comments
Hyaar_Emoy2810246conserved unknown protein
Hyaar_Emoy2810245conserved unknown protein
Hyaar_Emoy2810247hypothetical protein

Sequence
1699 bases(100 bases per row)
ATGTCCAAGTGGAGCAAAAAGCGCCGTGCCCCTCCCGGCTTCGAGTACATCGAGCCCGTCCTGGACGCGCTCGAGCGCGAGCTGCGGGAAAAGATGAACG
AGCCGCACGAAGGCAAGCGTCAGTGCGAGGCGCTGTGGCCCGTGCATCAGATCAACTGGCAGCGCAGTCGCTATGTGTACGACATGTTTTACAAGTACCA
CAAGATTCCTAAAAAAGTGTACGATCACTGCGTACAGTGCAAATTCGTGGACGCGAATTTGATTGCCAAGTGGAAAAAAAGGGGCTACGAGCGGCTCTGC
AGTACGTTCGCTATTAACCCCAAGAACTACAACTACGGGACCGTCAGTATCTGTCGCGTCCCGAGACAGCAGCTGTCGGAAGGGCAGATTGTGCAAGAGA
AACATAGTGGCTGTCGAGGGTGTGCGTCTGGCCCCGGGGGGTACTATAACATCTTTGGCAATAAGTACGGACAGGACTTGGCTCAGATCCAGCTTGCAAG
GGAGGAGAAGAAGGAGGAGGAGACGAAGCAGCAAGTGTGGGCCACGGAAGAAGAGGAGAAGGAGGAGTTGGAGAGTGGAGGAGAAGAGAAGAAGAAGGAG
AAGAGGCAGCGAGAGGGAGAGAGTAAGGAGAGTCAAAGTGGCAATGAGGAGAGTGGGAGTGAAGATGATGAGGCGGAAGCTCCGGTAAAGAAGCAGAGGA
AGGAGGAGTGAGACAGAGAGGGAGGTGAGTGATCTGCCAGTGTTGGTTGATTGTTTACCAAATAAAGGGGATGAGGTTCCACTTAGGCAGCTCGTCTTTT
TGATCGCGGAACTTGTGCTCGATCCATTGGGAGTTGAGGTGGGCGAGGAGGACTTGGTTGACCAGGACCCAGGTAGACACGAGGTAGAGCATGGGGATAC
TCCCGCCAGTGACCAAGAGGAAGCTGATGTAGAGCATCAGTTCAGCTGTGTAGAGTGGACTGCGCACCACGTTGAACCAGTCGCCGCGAGGAATCACGTA
ATTCATGTGATTCGCACGCTTTTGCTGTGCTAGGAGGTAGTTACAGCGGGATTGATGGTATGACGCCAGCATGAAAAGCACGAGACCGAGTCCCGTCATA
ATTGTACGACCATTGGTGTCTGGATGGTGCGTGATGGCGTCAGGATCAAACTGGACGGACAGGACCGTGGCCACGTAATGGTACATGCCTACGAAAAGTA
CTGATTATAGGTATTGTGTCAGTTCAATCACTTTTTTTTATCGGACGCAAAAAAAAGCAGAACGTTGTGACTTACTACTTGCGTGCATTTTGGCCGTGCC
AAACTCAGTGACCAGGAGTGACTCGATAAAGCGTCGTGTCGTATGCGCTGCAAACAGCATAAGGAACGCGATAGCGTGTGGCTGGATCGTGATATCATTG
GTCGTTTCTTGATCCGTCGATGGATGGGCGACGTGCAGCGCATCTTGAACGACTTTTGTGTGTTGCCAAAACACGATAGCGATCAGTATGAAATTGCCAT
GTAGTGCTGCAATGAGGTAGAACCACGTCCAGTAGCTCTTGGGCATTTCCACCCGCAACAGCCATAGGTTGGGAAGACGTGCCGAAGTGCGCGTCTTGCC
CTGCAAAACAAATGCACGACAGACATCACTTTGGAATGACAGCAATGCAGCAGCAATAGCTAGTATCCACGTGAGTTGCCACAGCTCTAGCAGTCCCAT