Description :
From Genome Similarity Track
Location :
Scaffold_16:137144- 140279
Transcript NameFunction/comments
Sapdi_VS20SDRG_05900hypothetical protein
Sapdi_VS20SDRG_05901hypothetical protein

Sequence
3135 bases(100 bases per row)
CCGGCGACGATCGACGATCGGCTAAGACGACGTGTAATATTATATTTCTGTGTTCGGCGCTTGGTGGAGGAGTGACGCCAGCCGCTGACGACCGACACCA
GCTCACTCGATTCGATGCATACAGTGTATGTTGTGCTGCATCATACGCTGTCTGGAGGCAGCGTGCCAGCCAAGAGCCATGTCCTTCCAAGAAAGACGCG
TTGCGGGAAGGGAGTCGCGGGACGAGACGGCGACGCCAATGTCGCGTCGCCCACCCGTCTACGATCGCATCTGGTTTGGCGCCACACCGGTCGACAGCGT
TGGTTTCACGCACGTGGACTCACTCTCTTTGCATGTGCTCTCCTCGACGCACTCTCTACCCTCTTTGGCCCGACGCGGATATCCTTGGCACCAAATTGGC
GCAGGCGATGGAATCGTCAAGGCGTCTCGGGCAAGCTTCCGTCGTTGCTTGAGGATGCTTCAGGATGCTTGCTCTGTGGATCTGTGGCGTGTCCAGTGCG
AGGGAGCGCGTCGTCCAACCCCAGTGGTCCAACAGTATCTCTTGTCGGGACGATTCGGTGGCTTCTGGACGTGGAACTTTAACCTTCCGCACTCCAAGTA
TAGTTTCGAATAGGTCTACTGAGTGTATCGCAGTGGTGTGAATACATCGATGATCGAACGTTCACGCCAAAAAAGTCCGTCGAACGAAAAGGTTGGAGCT
AGCCATGTACTCGAGATCAGCACCGACTTCAACCTCGACTCGTCGCCTAGGATTTGTACGGGCTGTACGTGAGGCCATCGCGCCCATCACGGACAGAAAT
CAAGCGCGGACAGTCCGGTCCTTGACGCATATCAACACCAGCATCAACCCTCCCGCTCGCCACTCCAAGGCACTCTAGGTGGCCGATAACCATCACGGGC
TCACAAATATTGGCGCCAATGACGTTGGCACGGACAGCTCTGGACGCGCGTTGTCTCTGGCCCATCGTTCGATCTCGCATTGCACGGGCTTGGACTGCGT
TTCTCAGGACCAAGCGCCTATCGTCACCTACGGTACCGGCGACGTCCGCATTTCCGCATGGCGAAAGCCGTGCCAGTCGAGCATACGGGGTACGTAGTAG
TCGCACGCCATCATCTCATGCAGCATTAGACCCACCAAGCAGGTTGTTCGAGATACATTCTAGAGTCGTCGCGAGAAGCGCTTTATGTTCGACACGTTGG
CGCCACGCTCGCGACGCGTCGACTCTCATGACCACTCTCACTCTTGAGAGCGATCCGGTCCGATCACTTTGGCGCTAAGTCCGAAACGACTGGCGTACGA
ACGCGCACTTTATCGAGCGTATAGCCGTCGTAACTATCCAACGTCCCGATAAAGTACGGGCGTTTGGACCGCCTGTCTTGGAATAAGCGCTTCGAATCGC
ACTTGAGCGGGTCCGAGACACGTCCCACCCTCCGGACCACAAATTTAAATGCAACGCAAGTGGGTGATGCATACAAATGGCAAATGATAAAATAAAAACC
GTGCGCGACGCATCCGACCAAGCCAGTTTCCTATTAAAAACCAGGCCATTTCGTGTCACACAAAAAGGGCGGGATCGTTTACCTTGGTGTTTGTATGTGA
AGCCGGTATTTAATTGCGTGAGTAATAAATTAAAAATTGAGCGGAAGATCGAACCCGAGGTTCAGCCAGTCGCACAGTCTATTTCATTACCCGACGCCGT
AGGCCCACCTCGACCCGTCCGATCGAGCTAGGTAGACGCGCTCCCTCCATGAGGTCGACCTCTAGGAAGGAAGCTCATGGAAGCATGCTTGTCTAGGCCT
TCTCGTTGACGTATATGAAAAGCCAGTACTCGTCTTCCTCTGCCCGACCTCCCAGCGACAAGCAGAGCGTGGCGATGCAGAACAGCGATGCGACGCGTCC
GTCGGGCCATCGCCGTGCGACCAAGAACTACTTCCAGCTCGAGTCCGACACGAAGCGCCAGAGCATGATGCAAGACGCCAACGACCGGTTTGGCAACCGG
CTCTCGATGATGAACGTTTTGCCGCAGCAGGACCAGGCCGAGTTCCAAGACGAGCGCTCGATCGACTACTGCTGTGAAGTGCTGCAGAACAAATTTGGTC
TCCAGGACGGGTCGGTCGACAACCAGCGCGAGCACGTGCTCCTTTTGCTGGCCAACTGCGCCGCGCGCGCCGGCACGGGCACGGCCGACACGCAGTACCA
CGTGCAGCTGCTGCACACGAAGCTCTTTGGCAACTACAAGGAGTGGTGCGGCTTTGTTGGCGTCAAGCCCGTCGCGTACGCCGAGCGTCTCTCGGGCACG
CCGCTGACGTCGCCGCTGCACATGGATCTCATGCTCTACTTTCTTATTTGGGGCGAGTCGGCCAACTTGCGGCACATGCCCGAGTGCCTCTGCTACTTGT
ACCACCAGATGCTCTCGGCGCTCCTTCAGGACGACCAGCACCAAGAGCGCCGTCCGCAGCAGTGGTTCCTCCAAGCCGTGGTCCGCCCGATCTGGAAGGA
GTGCTCGGTTATGCAGAAGAAGAACTCGCTCGGTCTGCACTACGAGCACACCAAGGTCCGCAACTACGACGACATCAACGAGTTTTTTTGGAAGAAGGGC
TGCCTCAAGATTGCGATCGACCAAGTCGCGCAGACGATCCACAAGACGCACGGCAAGACCTTTTTCGAGCACCGATCGATCTTTACGCTCATCCTCAACT
ACTACCGCATCTTCCACTTCAACCTCATGTTCCTCATCGGGCTCGCGGTCATCAACTACGTGGTCACGATCTCGCCCAACGGCGGCAAGTCGGGCTTCGA
CCAGTTTAGCGCCATGGGCAAGGTCGTCTCGCCCTACTCGACGCGCGAAGTCAAGAAGGTGGGCGTCGTTTTCATTGGCTCCCACGCGATTCTCAACGCG
TTCAAGTGCTTCCTCGAGGTCGGCCACGGCTGGAACCTCCTCGTGGACCGTCGGTCGACGTCGGCGACCTCGTCCAAGTCGATGACGTACGGCCTTGCGC
TCACGCTGCGCTTGATTTGGAACCTTGGCTTTGCGGGTCTCTTTGGTCTTATGGCGGTCTCGGCCATCCCGGCGGCGGGTGCGACGGACATTCTCACCAA
CCTCTCGCTGGCCTCGCTCGTGTACGTGGCGCCCG