Description :
From Genome Similarity Track
Location :
Scaffold_5:1371411- 1374132
Sequence
2721 bases(100 bases per row)
GATCCTGAAAGATCCGGCGTATATGTTCTGCCCTAGTATAGAGACTTTGTCACGAAGGGACTACCAATGAGCCTGCCTCCGGATCGAGGCGTGTGTCATG
AGATAGACCTGGTTCGTAAAACCAAATGCTGTGTGACAAGGCAATGGCCTTTGCTACGAGAGCGGAGTGACGTCATTGACGCATTCTTCCGTTTGAAGCA
CGAGGCCAGGATGGCGGGTGAGAGCAAAGCTCCGCATTCGACATCCACTTTCTGTGTCAGAAAGCCGAACGCTAAGTGTCGCATTGTTCATGTTTTCAAT
AAGCTTAATGCAGCCATCATTCTGGTACAGAGCCCAAATCCTCGCTAGTGTATCTGTCAAAACCATGGTAGGATGTACGCTGTACAGCGCACTCGACTTG
GGCGATAGCGCCTGCCAATTTCGCATGAGAGCGAGCGATATTTTGCTGACAGCGGTGAGTACTCCAGACGGTATGCTCTGGGAGTGACTGGTGATGCCTC
AGGGGCCGTCGAACGCACCAGCGACGTTCAATCGGCTTTTTACGCAGCTGTTCAGGCCCCATCGAGCATACGCTCAGACATATTTTGACGATATATTCGT
CCAAAGCCGTGCTGAGCACGTCAAGCCACATTGACCATTTACGAGCGGCGATTGAGTGCATACGCACTAATGCGCTGTATGCCAGCTTGGAGAAGTACGT
GTTCAGCGCAGAGGATATACCGTTCCTCGGCTGCTTCATTTGGAAACGTGGCTTGAGGGCAGATCCTGTCAAAGTCAAAATCGTCGAGGACTGGCATGTT
TTCGAGAGCCAGAAGGATTTACGCAAGTGGCTTAGCTTGGCCACTTACTTGCATAAATACAGCGCGAATTACACGGAGATGGGTCGGCCATTTTTGAATC
TCCTTTAGAAGGATGCGCCGTGGTGCTTGGATGTCATACTCGACGAAGCCTTTCATGCTGTGAAGAAGATCCTTCTTCAGGCGCTAGTACCGTCTGTTTA
GCGTCATCTGCGACGCCTCCGATTTTGCCGGGGGGGGGGTTACAACAAGCAGACGCCGAAGGGCGCGAACGTGTGATCGCGTTTGAAACTCGCCAGCTCA
TATATGCGGAGAGGAACTCCCAGTTCATGACAAAAAGATACTTTCCATTAAGTATGCTCTAGTCAAGTTCAGGGTACACCTGCTGGGCTCTAAGCTTCTT
GTGATATTTACTGATCAGGCGTCGTTACGCACTGCAACACAGACGCCACACCTCCCCCAGCGAATGGCGATATGGCTCTCATTCTCCGCCGAGTATAACT
GCGAGGTGAAGGACAAGCCGGGGCTGCTTAATGTAGTGGATGACGCGCTCTCGCGCAGACCGGACTATGAATTAGCCCATGTCACGACAGTGATGTCGTC
CATACGTGAGCTTATACGCGTAGCGTATGCACAGGATGTCATGTACGTAGCCCTTCTACGAGCTCTGGGAAACGAGGAGCTTAAAGACTTTGAAAAGGAA
TTGTCTGGGCGCCTACGCGAGGATACATCGATACACTCTCGATGGTGGCCTGCTGTACTTCAGTACTAACATTGAGGACACTCTTCGTGTCGTTGATCCT
CATGATGAGGACCTCAAGTATCGAATCCTCTATGAGGTTCGTGATACACCCGTCGGTTGACACTTGAATCATGAGAAGACATATGGCTCGGTGAGCTCGA
TGTACTGGCTCAAGCTGTACAAATAGATGAGCACCTACGTACGCACGTGCGAGACGTGTCAACGGACGAGTCTACAAAGAATGCGGCAGCGCCGTTGGAA
ATCTTGGCTGTCCCCACGTAATGTTAGGCGTCCATCAGTATGGACTTTGTGCTCGGCCTTCTGAAGGTTAAGGCGGGCAGCACAAGCATCGTGGTCTTCG
TCGACCGATTTAAGAAGATGGCTCACTTAGCGGTGGTGCCGGATACCGTCGACGGTGAAGGTACAGCGTTGCTTCTCATAGACCGTGGCTTTCACCAACA
TGGCTTGCGAAGGTAATAGGCTCGGATCGATACCCGCACTTTACTGCGAAATTTTGGACGTCCTTGTTCAAGGTGCTTGACATCCGTTTGGACGTGTCCA
CAGCGGATCACGCGCAGACCGATGGCAATACTGAACGCACTAACCGCGTTGTGGAGGACATTCTCCGAAGCGTATGCGCTGAGGTGCCGAAAGACTGGCG
CCAGATTCCCCCACTCGTCGAGGTCGCATTGAACAATGCGGTGCATGCATCGACAGGCTTTACTCAGTTCTATGTGAATGTCTTGACCGATCCTCGCGTC
CCGCTGACGCCACCACGCAAAGGTTCAGGGGTTAGTGGGGGAGGAGTAGCTGAGCAGCTTGCTGATATCAGCCCTGTTGCAGCTCGCAACAAGTCGATGA
CTTTGTCTCGCTGAGTCTTAGCGTTATGCGTCAAGTACGCGACGCTATGGCCGAAAGCCTAGACCTGCAAAAAGAACATACTGTTGCGCGAAGCCGAGGC
AATGTTGAAGAGTTTAAGGTTGGGGACCTTGTTTTATTAAAAGTAAAACAAACCTACCTACACATGCAGTGTCCGCGGTCTTCAAGCCCAAACTGAGACA
TCGGTCTATCGGACCTCTCAAGGTTATGGGCAGAAGGGCCTAGCGTACACGCTCAACCTTCCGAAGATGATGCAGACATCCGGTCTTCTATATGGTCTTG
CTCAAGCCGTACCAGGGCCCT