Description :
From Genome Similarity Track
Location :
Scaffold_2006:1371- 3297
Sequence
1926 bases(100 bases per row)
TTAGATCGGGTGCAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAGATAGGGGAGCATGCGGTGAAGTTGG
AAACGGCAGGTACCGAATATCGCTTGCTCCCTGTAGTACACGTATCCAAACTGAAGTTGGTCAGGAAATATCCGGACCGGCCGCAAACCCGTCTTTCGGT
GGATGAATCCGACCGGGAGGATTTCGACGAAGTACTCCTACCTGAAGATAGTTGGAAGGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACC
GATATGAGGTCAAGGAAGCGAACTAGGTACGGACGGATTTACCGTGAATTTCTGGTGTACTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGACAG
ATCTGAACTATGGAGCATTACTCTATGATTCTTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGAGGAG
CCATGGGTGTGAGTCGGTCATGTCGATGGGAGTATGAAAAAGGACCCCCAGGAAGGGTGTGGGTCAGGAGGAGGAGGATCACTGGTGTGAGCTGGTCATA
TTGGAAAGAAAGAGAAGAAGAATCCACAGGAAGGGGTGGATCAGGATGAAGAGGTGAATGTTTATGCATAATGAGTGACGCTTTACGTGCAAAGAGTCCC
AAACCAAACGCGAGTTTTTCGGGGCTCGGATCATACTGGTCTAACTGAGACTCGGTCGTAAGAAGTGTATTCGGCCCAAGTCCGAGCGCGGATCCAACCC
GGATCCCGAAATTGTAACGGATCCAGGTGTATGCTGAAAGGGTGGATCCAGCCCAGATCCAGGCGTACCCTGAAAGGGTGGATCCAGCCCAGATCCAGGC
GTACGCTGAAAGGGTGGATCCAGCTCAGACCCAGGCGGACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACGCTGAAAAAGTGTATCCGGCCCGG
ATCAGGTGTACGTCGGAGGGCTCTGACATAGCTTCTCAATCAACAAGAGAATGTTAAAGACATATTCAGGTAGAATGTTAAAGACATATTCAAGTAACGA
AGAGTGAATTATGATAGCTTATGTAAAAAGGCTAGCTCGACTCAGCTTCCAGCCGCTACTTACTACTACGAAGCGGATCCACGAGGACTGGAACTGGGGG
CGCAGCGGGAAAGAGCGGTATGGATCAGGTGGTGTGGGGGCTGAACGTTGAAGAACTTGCCCGCCAAACGCTGGATCCGGTGTCCTGGATGTTGGCTGGG
GTTCCCCCGAAATTGGGTGCGCCAAGGCTCGACTTCGTCAATCTCTTACAGAGCCGCCACTAAGCTCCTAGGTTCCGGGCGGTGGAGGCTGGGATTTCCC
AAGTTGGCTTGACGAGATACGGATCCCGGAAACCACGTTACCTTATCCCCGCGTCGAGGAAGGTGCAAGAAGGATGGATCCAACAAGATATACACGTCAC
ACCAACCGTCTTGGATCGCTAGCACGAAGATCACGGAAACCTTCTTCCAAGCCCGACCGGCGTGACTGCTTCTGTTACCGCGCTGCTTGTTGAAGTTCGA
CAGCCATGTCAAACTCCGCAGTCGGGCACGAGAGACAGGGAACCGATGGGAGCCTTCCCATATGGCAATTCGGTGTTTGGAAACGAAATCTCGGAAGGCA
CCAACGAACAGCCCGAGACGTCCACCGACGTCACCTCGGAAGCTAACAGGATCCACCAGCGTGGTCGTCAAAATATTCCATGGTGCGGTATTATGTAACT
CTTCCACGTGAGATCTGGTGACGAGCGAATCCACATATCCGGACGTCGGCATGTCATCCTCTTCGCGAGGGAATATCCACTCAGTACGGAATTGCAGCTC
AGGGAATAGGACGGTGATCTTCATGG