Description :
From Genome Similarity Track
Location :
Scaffold_8:137092- 139392
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05681hypothetical protein

Sequence
2300 bases(100 bases per row)
TACCGCAAAAGTCAAATAGATGCAGCACGCTCTTCTAATCAAATGTTACATCTTTGTGAAAGGGATTGTGTACGATTTGGAAAAGCTTTGCATAAAATAA
TCGCTTGATACAAATTTCAAGTTCATTCACTCCTTTGTACTGACAATAAAAATGATGAGGCGTTCGTACACGATCTGCTCGTATTAGTTTTTGGTAGATA
AAATGGACAAGTCCTGCACTTATCCGGGAATAGGTATTCCCACCACGGGTAAAATGACTCGACCGGTGTATAATTGCATTTTTAATGCTGAAGGCGACTC
TCTCTGCCGTGTATTACGGCGAACACGTAACAACGTAAAAAGTAGGTACTTCCTCCGTTCACAACAACCAGGGACAATTCAGAATGATGGTCAAATCGTC
AAGGTCATAGTAAATCCGCTTACCTGGCAGCACCTCACGGTCAATTCGTCGAGAACATCGCGATCGTCCCCTCTGCGGCTAGATTTCGCATTGCATTGGT
TAGATACACTATCATCTAAGTCATCGACCTTGTAGCGTTTCCAGATCCTACCGACAAGTTCATATTTACCGACAATACACCTTTAGCCAGCATTTTTGCC
GCTTGAGGCCGCTCACCTTGCATACTGGCACCTTAAAGCTGCAGAAAGATGGAATGTCATGTCTTGGCATATGGGCTACTCTATCTAGTGCATGCTTTGG
GTGCCGCTACAGTTGCGCGGGCATGGCGTGTCGAAAATAATGGAGAGGTCTGACAGGAGGGTATTGTGGGGTCGACCCTGAGGCGTCTGATCACGTTGGG
ACTGGATCGCATAGGACTTCTCATCCAAAGGCGGAGAAAACCCAGCAGTACTTTGCTGTCCATGTATACTGCAACTACATGTATTGCCACACAGTATGTG
GCTGTAAGTTGTCTCTCTTTCGTACAGTTGAAATGTAGTTTTGTTTCGAAGATGTAAAATCTGCTATTTTTGTGTTTAACCAAAACAAAAACATGCTACT
ATTTTTATGTTAAGCCCTTTATTTTGTGATGTTAGGTACTTCAGCCCAAGCGTAGCTGGAAAATGGCGAGGCTGACAACGGCTCACGCTCCCGATGGTCC
TTGATGCCGACCTCCAGACACTCTCTGCCGGTCACCGACTTCAACGTGCACCAGATCTCTACCTCCTACGTCTCTGCGCCCGTGATCGTGCAGGGTGGAA
GGACTTAACAGAGGCGCTAATTGCACACACACCGCTTGACGGACTCTGGCCGAGAGATGAGAGAATCGTAGAGTACGAGAGATAACCCGACGCATGCGGA
AGTTGACCCACTACGGTGGCGAGACGGCTCGCGAAACGCGTTTACAATACAATACAAAAGGTAATCTAGTATTTTAGAAAAATGTAACCGCTCCGTCGTT
TTTGGAATTCAATTTTTTTAAGAAATATGGAAATAGCAATTATTGGTGATTCATCGACAATAATTATGTCCCGTATTTAGCGGACACTAATATCCAGAAA
AATTCTACTGTTAGCGAAGCGTCACACTGGATCTGTCTCCAAGCAAGCATGCGAAAGCGCCCGAACGCCTGCAACATCGCAGTCGCTGCCATTGGCAAGC
ACGACCGAGTTCAACTTACTCCAAAATCGTCGGTCGGCAAGAACAAAAAGTCCAGTGTATCCATCCCCGCTTTCCTCTTCATCCTGCTGGTTGGCGTTCT
GTTGATACAGAACTCGAACGTTGACAATCAATTATCAGAGGAGGAAAAGATTTCTACGTTCTTAAACTGGTTTCGGACGGCTGGTGGCAACGTCAGCAGC
AACATCGCAATTAAGATGTTTCCGGAAATGGGCAAAGGTTTGTTCCCTCAATATTTTTTTTATTTGGAATCTGGTGGTGAAACTCAAAGGAAAAATAATG
ATGTGTAGGTATTGTGGCGTTGCAATCTGTGAAGGAGAACGATGAGCTACTGTTCGTACCGACGAGTATCATTATGTGAGGTATTTATTCTGTTTCTAGC
AGACTGAAGTTTTCGCTAATTTCTCTTGTTGTTGTGCAATTTTAGTTGTTACGATACGGTTGCCACAGAGTGGAGCTCACATCCGAAGTTAAAGAAAAAT
TTAGTGAAATTAGAGAATGATCAAGAAGAGCTGTTGACGGCGTTTTTGGTGTGGGAGCAGGCAAAGGGACAAGCGTCTCCATGGGCTCCGTATTTGCAAT
TGTTACCATCATTCTCTTCGCGAAATGAAATCGCAACACCGCTCTATTTTGACAGTGAGGAAGATATTGATTCCTTGCAAGATGAACGCATGATTAACGC