Description :
From Genome Similarity Track
Location :
Scaffold_867:13707- 15118
Transcript NameFunction/comments
Phyta_totarag11113hypothetical protein

Sequence
1411 bases(100 bases per row)
AGTACCTTAGCTGCATCTTCAATCAACTTATCAGGTTTAGTCCCGAGTGTGATTGGTCCGTCAGGAACATCCAGTAGTTCTCCGTATGACGCCTCGTCTG
GAGCACGGACGTCCACGAACAgcatgtcgtcgtcttcaatgATGTAACTTGGTCATACCGCTTCAGCACATGCCGGATTCAGGCGTTGGACATATGGTCA
TGAGCGTTCAGGCTGCCGGGTCCCTCGCCGCAGGTGCCGATTCGGGCATGTACTTGACTCGAACGGTAATACCGGCAAAACAAAAGTGCTACAGATCAAT
ACGACATTGAAATCGATGAATCTGAAACTGTCGAAGTTCTGAACAGCGACGTTGCGTCCAAGGACGAATCTCTAGAATGAATTCTACGTTTAAGGCAGGA
AATTTGGACTCGTCACTCAATGAGTCGAGTCTGGCTATAGCTGGACACAGAGAGTTGTCGGTGACCTCACAGCATAACACACTGACACGCACATCTGGTC
GTTCAGTGGGGACGAAATCCAGCCGAACCAATTGGTCTCAGCGCTCAAGTTCGAATTCGTCAGCTACTTCTGGAGCCGCGCAAGTGGCACTAAACATCAT
GCGCCAACATCCACATTAACAATTCGTGGTTGAGCTTCAAGAGAAGCAAGAAGATTTTCAATAACGACAGCACAAGGTTCAGCTcaagttgcagctgaag
atAGACCGACAACTCGAGGGTACAGCTTACGAAATTCACTCGGTAAGAGAGGCGATGGCTCGCGCAGAGGAAGCGAAGCcccaagcagagcaagcaccTT
TACAGgccgaagaagcgcgtgttgaagctgaacgacGTGTCCAAGTTCTTGAAGCACGTTCAAATTCAGGGTTTCAGCAAAGTGCGTTGAGAACtcaaga
agagctggacacacaagttgctgaagcacttcgtcgagaacgagatcgcTTGAGCGTTGCAACGCGGAACCAAGTTGTGTTTaagcagcgctggcaacAG
TATGCGTCTCAGTCGGATACTGAACGCGCTCGCCAACTTGAAGAATTTGAACGAAAAGTGAATGCGCGGATGGAGTCTGCCAACAGACGATGCAAAGTCT
CAACTTAGAGCATCAGCATGAACGCGTAGAGCGAGAACAGGAACATCAAGCCGCCTATAACCGACACAAGTTTCTCGCCGGTCAGAATCACGACCTTCGA
ACAACGTTAGCGCAAGTTCAAGGTGCTCATGCAGGCTGCGCCCCTGATCCCGCAACTCGTATCAAGTCTGAAGTGCCATCAAACCCTCGATCGGCAAGTC
TGCATCTGGTATCCAGTAGCGCAGTCAAAGCTGATGCGCGGGCTAGTGCTCATGATGCTCTTTCAAAAGTCGTGACCGAAGTCGGTGCCGTTCAACTACG
TGCATTACTTT