Description :
From Genome Similarity Track
Location :
Scaffold_105:137037- 140103
Transcript NameFunction/comments
Phyci_238412Hypothetical protein
Phyci_12889Hypothetical protein

Sequence
3066 bases(100 bases per row)
AATCCGACGGTTGCAGGTAAATGGTAGCTTTATTTCCACTTCTATTCTATATACTGACAATCGTTATCACCATGTAAAGTCCCCAGTTAATTGCAACGTC
GCCACACGTAATGAGCGAAGGGGAAAGCGCGACAAGCTCACAAAGTGGTGACAGGACAACAGGCAGGCGAGTTTTGCTGACAATGCTATTGATTTGGGTG
GGAACTAACCGGTGTGTGGATGCTGTCTCCAGTCGCTGTAGCTGATGATGGCAGTAGTGATGAATGACCTGATTCACCCTCGGATGACGAAGAAACATCA
AAAGGATCTACGGCTCCCATTCGCACGCACGCACTAAACGAAGGAAAACGAAAAGCCCTCCAACATTCGGTATGTgtatcgtgtacttacaagctaatga
tacatgttatcaaacttaacgtgtattgttatattgtgttAGACGCTTTTGCAGAGGATCCAAACATTGTCCTCTCTGGCGATACCAGACCGCTCTTGGA
GCGTTCCTGCGTTTTGTGGTACCCCAACTGTGGATAAAATCGAAGGAGTGAATAATGGCTACTTTGACGCGAACGTTGACGAGAATGTTGACGAGAACTT
TGACGCGCGCGTGCAAGCACAACATGTCAAGCAAACATACCCGGCACGAAGGCAACCAACTTTTCAAGTGCAAACCGCACAACAAATCAAGTCAACTGTG
AAAAAAAAAAACTTGAAATGTCGGGCAGAAATCTTTGTATCTTTATTGGTCTTCTTACAGTCATTCGGGCCCAATTCACTcgctggtggggtaaccaagg
ggtcttcgtgttcgcagcaggaggcagtgctacgcaggaccgtattgtacgttgtgatccagctaccggagaacaagctgaattagtgtgtccatgaatc
aagaaggactaccagactttcgtgggcggtgttgatgtccacgataaactacgcctacggcgacaagttccctaatcgtgtacacacaactttgcgctaa
acggccaacgtgtatcatacaacaggtattcacttcagctgaccagatgcttcaaaaagtactacaagtcgttgtttctcggcctaattggcatgccaat
tagcaatgccttcatcatttacaacgcacgccgcatcaccgaaggtaagagcaaggtatctcgtcaactttctaaagcagctacacatggagctctgtca
GTTCCAACCGAGCGACTGGGGACCAACTGCTGCATCACGGCCTCCAACATTGTACATACTGACGAGTGGGGGAAGGGCAGCGGCGAGAAAATGCGGAAGC
GCAGACGGCGAGAGTGCAAAGTTTGATTAGTGTTGAAGGGCGCGAGTAAAGCGCGTGAAGGGGAGACGGCGTTTTACTGTGTGGTATGTAATCTGAAGGC
CGCCTCGGTGGTAATGCGATTCGGTTGGCTAGTCGAGCGACGATTCGGCAAGTGTCGCTCCCCCGAAGCGGCTTCAGCGTACACCCGCCATTGATGACTC
GGACACGGTCCACGTAGGTGTAATTGACTCGATGATAATtgtagtagatctaacttgactcactactttagcttacacgttgcgcaacgtgtatgaggaa
gcgtaagtacttagtaataaattgagttacttatacttgggtacacaagtataatataaatcaattaaagactccaagtagctagtttaaggtgaaatga
gaactgtattgtgtgtgaattgatcttcctcctaaatctgctaaaaactgtctatcatctatgaaaggggttgacagcggctggctgtctgagccccgct
actatgcatgtctctgattggtagaaagatgctgctttctaccaataggacctttggttatgtgtggaccactcattgtggtggcccacttcactgtatc
cattggtgtggcttacaccaaggcgaggaagtatctaaaactcttaacaaatattttatctgttaaattcacaagtggtttgtatccacttgtgcatgta
accccgttacaccatcccccccttaaggttagacgcgcgggatccccacacgtcaatttctgaattgatcattcgtcaattctccgcgtttggagaagaa
acccgcgctcattcaacgatgaacgcgccccaggagaagaagaacccgaaggcggtggagagtcatctctccatcgacgactacttcgaacgccagaagg
cgaagtacggcgacgtcgtcgacttcgacgacgacgatgaagacatggaggacgaggacgactcgccctcaaagcgtaaagactcagtgtcgagcgaatc
gcgcgaccctcatgcgaagaacattcgcccgagtgaaagggacgaatcggacgtttcgagctcgaagcgttcgcgaactgagagcgataccccacacgct
tccgctggggctctcagtactccgcgcgctgctgctgcagcgcgtgatgtcaaagctcaaggctctccgcgcNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN