Description :
From Genome Similarity Track
Location :
Scaffold_59:137033- 138172
Sequence
1139 bases(100 bases per row)
GATCCGAATTCTTGTATTATTCCACAAGATATTTCTAACATGAGGAATGCGACCCGGCGCCGAGAGATGGCCTCGCATACGGTGAAGGATGCTCTTTATG
AAACGCTGGGTGAACATGACTTTTACTATAGGTGGGAGGCTGATCCCCAAACTCAACAATTGTTATATTTGTTTTGGGGGCATCCTGGTACGCTCGCACA
GTACAGAAGACATCCATATAGCGTGGGTATGGATTGTACTTACAAGACCAACAAGTACAAGTTACCACTTCTTAACATCATTTCCCTGACGGGGTTCAAC
ACTGTCCTTCCAGTGGCGCAGTGCTGGCTACCAAGAGAGCGGGAAGAGGATTATCGTTGAATGATGAATACTTACCGAGTTTTCTTGGAGGAGAACACCA
TTGCGTTACCGAGTATCCTTCTTACGGATCGAGAACTGGCGTCTATGAATGCTATCGATTTTGTATTTCCTGGGGTCCCAGCCATAATATGTCGTTGGCA
TATGAACAAGAATGTACTCAGCAAGACCCGTCAGGTTCTTGGGCAAGTTCCTGTCCAGAATCCAGCTCCGGGCCAACCTAAGTATGAAAATACCTGGCAG
ACAGATTCTTTCATGAAATCGCTCTACGACACTGTGGATGCAATAACTGAAGCAGATTTTGAAGTAAAACGACAAGGTCTTCACCGTCGGAATCCTCATC
TAGCCGAGTACCTTAAAAATCCCTGGTGGAAATACAAAACCAAAATTGTTGCAGCATGGGCCGATTGCTACAAGCACTTCGGAGTTAGAGATACCTCTTT
TGTTGAAAGAGATCATGCCAAGTGTAAGATCTGGTTGCGCGGGTGTAGATACGATCTCTACACAGTGTTTTTACGGCTACTTCCGTGGTGGAAAGGGGCA
ATATCTGCTACTAGTCTTTTAGCAGAGCGCAATTCAACTCAGGTACCTTATCTACCTCAGGGGAATCACTTTGTAGCGGTAGCTCGTGTAATAACGGTGT
GGGCACTTACAGAGACCCAAACGTTGTGGTGTGAAGCGCGAGAAATTGCCTACTCTCCCGCCGATCGGGATGGATGCACAGGCCGGTTTCGAGGTGTTCA
TGGTCGTCCTTGTGTGCACGACTTGGTATCAATCATTGA